<?xml version="1.0" encoding="UTF-8"?><rss version="2.0"
	xmlns:content="http://purl.org/rss/1.0/modules/content/"
	xmlns:wfw="http://wellformedweb.org/CommentAPI/"
	xmlns:dc="http://purl.org/dc/elements/1.1/"
	xmlns:atom="http://www.w3.org/2005/Atom"
	xmlns:sy="http://purl.org/rss/1.0/modules/syndication/"
	xmlns:slash="http://purl.org/rss/1.0/modules/slash/"
	>

<channel>
	<title>AGP alternatives,Anticoccidials,Antibiotic substitutes&#8212;Phiphar healthcare limited</title>
	<atom:link href="https://www.phiphar.com/feed/" rel="self" type="application/rss+xml" />
	<link>https://www.phiphar.com</link>
	<description></description>
	<lastBuildDate>Tue, 04 Nov 2025 03:15:38 +0000</lastBuildDate>
	<language>en-US</language>
	<sy:updatePeriod>
	hourly	</sy:updatePeriod>
	<sy:updateFrequency>
	1	</sy:updateFrequency>
	<generator>https://wordpress.org/?v=6.2.9</generator>

<image>
	<url>https://www.phiphar.com/wp-content/uploads/2019/02/cropped-2透明底-e1550647076619-32x32.png</url>
	<title>AGP alternatives,Anticoccidials,Antibiotic substitutes&#8212;Phiphar healthcare limited</title>
	<link>https://www.phiphar.com</link>
	<width>32</width>
	<height>32</height>
</image> 
	<item>
		<title>Effects of Youtide on Broiler Chicken Production Performance</title>
		<link>https://www.phiphar.com/effects-of-youtide-on-broiler-chicken-production-performance/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Tue, 04 Nov 2025 03:15:38 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=1134</guid>

					<description><![CDATA[Effects of Youtide on Broiler Chicken Production Performance Abstract: 12,000 healthy 1-day-old Ross 308 broiler chickens with an average weight of about 42g were randomly divided into two groups: the control group (0–21 days, basal diet + 35.0g/t Bacitracin Methylene Disalicylate (BMD); 22–42 days, basal diet + 20.0g/t Bacitracin Methylene Disalicylate (BMD)) and the experimental [...]]]></description>
										<content:encoded><![CDATA[<h2><strong><b>Effects of Youtide on Broiler Chicken Production Performance</b></strong></h2>
<p><strong><b>Abstract:</b></strong></p>
<p>12,000 healthy 1-day-old Ross 308 broiler chickens with an average weight of about 42g were randomly divided into two groups: the control group (0–21 days, basal diet + 35.0g/t Bacitracin Methylene Disalicylate (BMD); 22–42 days, basal diet + 20.0g/t Bacitracin Methylene Disalicylate (BMD)) and the experimental group (0–21 days, basal diet + 250g/t Youtide; 22–42 days, basal diet + 200g/t Youtide), with four replicates per group and 1,500 chickens per replicate. Results showed that compared to the control group, the experimental group exhibited improvements in feed intake, daily weight gain, and feed conversion ratio across all stages and the entire period, although these differences were not statistically significant (P&gt;0.05). The mortality rate over the entire period decreased by 35.06%.</p>
<p>&nbsp;</p>
<p><strong><b>Keywords: Youtide; broiler chickens; production performance; mortality rate</b></strong></p>
<p>&nbsp;</p>
<p>Antimicrobial peptides derived from animals are crucial effectors of the innate immune system. Numerous studies have shown that antimicrobial peptides possess antibacterial, antiviral, antifungal, antitumor, and immune-boosting properties, making them ideal substitutes for feed antibiotics. Youtide, developed by Guangdong Rongda Biology Co., Ltd., is a high-activity antimicrobial peptide product expressed using modern bioengineering techniques with Bacillus licheniformis as the host strain. This study investigates the effects of adding Youtide to the diets of 1-day-old Ross 308 broiler chickens on their production performance, providing scientific evidence for antibiotic-free commercial broiler farming.</p>
<p>&nbsp;</p>
<ol>
<li><strong><b> Experimental Time and Location</b></strong></li>
</ol>
<p>&#8211; Experimental time: December 20, 2018, to January 30, 2019, lasting 42 days, with the initial phase from 0–21 days and the later phase from 22–42 days.</p>
<p>&#8211; Experimental location: A large broiler chicken enterprise in Zhaoqing, Guangdong.</p>
<p>&nbsp;</p>
<ol start="2">
<li><strong><b> Materials and Methods</b></strong></li>
</ol>
<p><strong><b>2.1 Materials</b></strong></p>
<p>&#8211; Youtide: Provided by Guangdong Rongda Biology Co., Ltd.</p>
<p>&nbsp;</p>
<p><strong><b>2.2 Experimental Animals and Design</b></strong></p>
<p>12,000 healthy 1-day-old Ross 308 broiler chickens with an average weight of about 42g were randomly divided into two groups: the control group (0–21 days, basal diet + 35.0g/t BMD; 22–42 days, basal diet + 20.0g/t BMD) and the experimental group (0–21 days, basal diet + 250g/t Youtide; 22–42 days, basal diet + 200g/t Youtide), with four replicates per group and 1,500 chickens per replicate.</p>
<p>&nbsp;</p>
<p><strong><b>2.3 Experimental Diet</b></strong></p>
<p>The basal diet formula was prepared according to NRC (1994) nutritional requirements. The composition and nutritional content of the basal diet are shown in Table 1.</p>
<p>&nbsp;</p>
<p><strong><b>Table 1: Basal Diet Composition and Nutritional Content</b></strong></p>
<table>
<tbody>
<tr>
<td width="166"><strong><b>Composition</b></strong></td>
<td width="143"><strong><b>0–21 days (%)</b></strong></td>
<td width="117"><strong><b>22–42 days (%)</b></strong></td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Corn</td>
<td width="143">57.30</td>
<td width="117">63.85</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Soybean meal</td>
<td width="143">30.00</td>
<td width="117">20.30</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Cottonseed meal</td>
<td width="143">2.00</td>
<td width="117">3.00</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Rapeseed meal</td>
<td width="143">1.00</td>
<td width="117">2.00</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Corn gluten meal</td>
<td width="143">3.00</td>
<td width="117">4.00</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Fish oil</td>
<td width="143">2.50</td>
<td width="117">3.00</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Calcium carbonate</td>
<td width="143">1.60</td>
<td width="117">1.50</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Dicalcium phosphate</td>
<td width="143">1.30</td>
<td width="117">1.05</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Salt</td>
<td width="143">0.30</td>
<td width="117">0.30</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Premix</td>
<td width="143">1.00</td>
<td width="117">1.00</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Total</td>
<td width="143">100</td>
<td width="117">100</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Nutritional Content</td>
<td width="143">&nbsp;</td>
<td width="117">&nbsp;</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">ME (MJ/kg)</td>
<td width="143">12.28</td>
<td width="117">12.77</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Cpr (%)</td>
<td width="143">20.56</td>
<td width="117">18.43</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Lys (%)</td>
<td width="143">1.13</td>
<td width="117">0.91</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Met (%)</td>
<td width="143">0.46</td>
<td width="117">0.39</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Trp (%)</td>
<td width="143">0.21</td>
<td width="117">0.19</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Thr (%)</td>
<td width="143">0.84</td>
<td width="117">0.77</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">Ca  (%)</td>
<td width="143">1.01</td>
<td width="117">0.86</td>
<td width="38">&nbsp;</td>
</tr>
<tr>
<td width="166">AP  (%)</td>
<td width="143">0.35</td>
<td width="117">0.33</td>
<td width="38">&nbsp;</td>
</tr>
</tbody>
</table>
<p>Note: Each kg of feed contains phytase 100mg, Fe 85mg, Zn 120mg, Mn 105mg, I 1.1mg, Se 0.3mg, VA 12000IU, VD3 3300IU, VE 50IU, VK3 3.5mg, VB1 2.5mg, VB2 10mg, VB6 6mg, VB12 13ug, calcium pantothenate 20mg, niacin 45mg, biotin 150ug, folic acid 1.65mg, choline 500mg. Metabolizable energy calculated based on ingredient composition, others are measured values.</p>
<p>&nbsp;</p>
<p><strong><b>2.4 Management</b></strong></p>
<p>Four-layer cage farming was used with free access to feed and water. Light, temperature, humidity, and immunization procedures in the chicken house were strictly in accordance with conventional management requirements. Temperature and humidity changes were recorded daily, and the health status of the flock was observed.</p>
<p>&nbsp;</p>
<p><strong><b>2.5 Measurement Indicators</b></strong></p>
<p>Chickens were weighed after 12 hours of fasting (with free access to water) on days 1, 21, and 42. Feed consumption and the number of chickens were recorded to calculate the average weight, daily weight gain (ADG), average daily feed intake (ADFI), feed-to-gain ratio (F/G), and mortality rate at each stage.</p>
<p>&nbsp;</p>
<p><strong><b>2.6 Data Statistics and Processing</b></strong></p>
<p>Data were statistically analyzed using SPSS 12.0 software. One-way ANOVA was used for variance analysis, and differences were considered significant at P&lt;0.05. Results are presented as mean ± standard deviation.</p>
<p>&nbsp;</p>
<ol start="3">
<li><strong><b> Results and Analysis</b></strong></li>
</ol>
<p>The effects of Youtide on broiler production performance are shown in Table 2.</p>
<p><strong><b>Table 2: Effects of Youtide on Broiler Production Performance</b></strong></p>
<table>
<tbody>
<tr>
<td width="101"><strong><b>Feeding Stage</b></strong></td>
<td width="134"><strong><b>Indicator</b></strong></td>
<td width="142"><strong><b>Control Group</b></strong></td>
<td colspan="2" width="147"><strong><b>Experimental Group</b></strong></td>
</tr>
<tr>
<td width="101">&nbsp;</td>
<td width="134">ADFI（g/Bird）</td>
<td width="142">51.52±2.46</td>
<td width="121">51.89±3.54</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">0～21d</td>
<td width="134">AM（g/Bird）</td>
<td width="142">41.65±2.05</td>
<td width="121">42.23±2.67</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">&nbsp;</td>
<td width="134">F/G</td>
<td width="142">1.24±0.18</td>
<td width="121">1.23±0.13</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">&nbsp;</td>
<td width="134">ADFI（g/Bird）</td>
<td width="142">133.16±3.67</td>
<td width="121">133.55±5.41</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">22～42d</td>
<td width="134">ADG（g/Bird）</td>
<td width="142">82.55±3.34</td>
<td width="121">83.81±3.65</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">&nbsp;</td>
<td width="134">F/G</td>
<td width="142">1.61±0.11</td>
<td width="121">1.58±0.18</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">&nbsp;</td>
<td width="134">ADFI（g/Bird）</td>
<td width="142">92.34±5.22</td>
<td width="121">92.72±7.72</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">0～42d</td>
<td width="134">ADG（g/R）</td>
<td width="142">62.11±4.62</td>
<td width="121">63.02±3.58</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">&nbsp;</td>
<td width="134">F/G</td>
<td width="142">1.49±0.07</td>
<td width="121">1.47±0.13</td>
<td width="26">&nbsp;</td>
</tr>
<tr>
<td width="101">0～42d</td>
<td width="134">Mortality rate (%)</td>
<td width="142">4.25</td>
<td width="121">2.76</td>
<td width="26">&nbsp;</td>
</tr>
</tbody>
</table>
<p>Note: Different letters within the same row indicate significant differences (P&lt;0.05).</p>
<p>&nbsp;</p>
<p>As shown in Table 2, adding Youtide to the basal diet improved feed intake, daily weight gain, and feed-to-gain ratio across all stages and the entire period compared to the control group, although the differences were not significant (P&gt;0.05). The overall mortality rate decreased by 35.06%. This indicates that Youtide can achieve the same effects as BMD.</p>
<p>&nbsp;</p>
<ol start="4">
<li style="text-align: left;"><strong><b> Conclusion</b></strong></li>
</ol>
<p>In summary, adding Youtide to broiler diets can improve production performance and reduce mortality rate, making it a suitable substitute for antibiotics.</p>
<p>&nbsp;</p>
<p>&nbsp;</p>
<p style="text-align: right;">Qingyuan One Alive Institute of Biological</p>
<p style="text-align: right;">Research Co., Ltd.</p>
<p style="text-align: right;">2019.2.18</p>
<p>&nbsp;</p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Effects of Sanguinol Supplementation in Low Protein Diets on Broiler Performance</title>
		<link>https://www.phiphar.com/effects-of-sanguinol-supplementation-in-low-protein-diets-on-broiler-performance/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Wed, 01 Oct 2025 14:55:35 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=1124</guid>

					<description><![CDATA[Effects of Sanguinol Supplementation in Low Protein Diets on Broiler Performance Research Background The main active components of Sanguinol, sanguinarine and chelerythrine, possess strong anti-inflammatory activity. They can reduce intestinal inflammation, minimize ineffective energy and nutrient losses, improve gut health, and enhance the digestibility and absorption of dietary nutrients, thereby improving nutrient utilization efficiency, animal [...]]]></description>
										<content:encoded><![CDATA[<h1><strong><b>Effects of Sanguinol Supplementation in Low Protein Diets on Broiler Performance</b></strong></h1>
<h2><strong><b>Research Background</b></strong></h2>
<p>The main active components of Sanguinol, sanguinarine and chelerythrine, possess strong anti-inflammatory activity. They can reduce intestinal inflammation, minimize ineffective energy and nutrient losses, improve gut health, and enhance the digestibility and absorption of dietary nutrients, thereby improving nutrient utilization efficiency, animal health, and growth performance. To investigate the effects of dietary supplementation with Sanguinol in low-protein diets on growth performance, health status, mortality, European Production Index (EPI), and uniformity of broilers, the present study was designed.</p>
<h2><strong><b>Research Objective</b></strong></h2>
<p>To evaluate the effects of dietary supplementation with Sanguinol in low-protein diets on growth performance, health status, mortality, European Production Index (EPI), and uniformity of broilers.</p>
<h2><strong><b>Materials and Methods</b></strong></h2>
<p>3.1 Experimental Design<br />
A total of 500 healthy, active, and uniform one-day-old AA broiler chicks were randomly assigned to five groups according to Table 1, with 10 replicates per group and 10 birds per replicate (the number of experimental animals may be adjusted according to practical conditions).</p>
<p>&#8211; Group 1 (CN): Fed a non-antibiotic basal diet (CP: starter 21.5%, grower 19.5%).<br />
&#8211; Group 2 (LPB300): Fed a low-protein diet (CP: starter 20.5%, grower 18.5%) supplemented with Sanguinol at 300 g/mt (0.15% sanguinarine hplc).<br />
&#8211; Group 3 (LPB500): Fed a low-protein diet supplemented with Sanguinol at 500 g/mt (0.15% sanguinarine hplc).<br />
&#8211; Group 4 (LPAA): Fed a low-protein diet supplemented with synthetic amino acids (Lys, Met, Thr, Try).<br />
&#8211; Group 5 (LPAAB300): Fed a low-protein diet supplemented with synthetic amino acids (Lys, Met, Thr, Try) plus Sanguinol at 300 g/mt (0.15% sanguinarine hplc).</p>
<p>The formulations of the basal diet and low-protein diets are shown in Table 2.</p>
<h3><strong><b>Table 1 Experimental Groups and Dietary Treatments</b></strong></h3>
<table>
<tbody>
<tr>
<td width="240"><strong>Group</strong></td>
<td width="240"><strong>Code</strong></td>
<td width="240"><strong>Dietary Treatment</strong></td>
</tr>
<tr>
<td width="240">1</td>
<td width="240">CN</td>
<td width="240">Basal diet (normal protein; starter 21.5%, grower 19.5%)</td>
</tr>
<tr>
<td width="240">2</td>
<td width="240">LPB300</td>
<td width="240">Low-protein diet (starter 20.5%, grower 18.5%) + Sanguinol 300 g/mt</td>
</tr>
<tr>
<td width="240">3</td>
<td width="240">LPB500</td>
<td width="240">Low-protein diet + Sanguinol 500 g/mt</td>
</tr>
<tr>
<td width="240">4</td>
<td width="240">LPAA</td>
<td width="240">Low-protein diet + supplemental synthetic amino acids</td>
</tr>
<tr>
<td width="240">5</td>
<td width="240">LPAAB300</td>
<td width="240">Low-protein diet + supplemental synthetic amino acids + Sanguinol 300 g/mt</td>
</tr>
</tbody>
</table>
<h3><strong><b>Table 2 Basal Diet, Low-Protein Diet</b></strong></h3>
<table>
<tbody>
<tr>
<td rowspan="2" width="114">&nbsp;</p>
<p><strong>Ingredient</strong></td>
<td colspan="2" width="205"><strong>Basal Diet</strong></td>
<td colspan="2" width="205"><strong>Low-Protein Diet</strong></td>
<td colspan="2" width="205"><strong>Low-Protein + Amino Acid Diet</strong></td>
</tr>
<tr>
<td width="102">1–21 d</td>
<td width="102">22–42 d</td>
<td width="102">1–21 d</td>
<td width="102">22–42 d</td>
<td width="102">1–21 d</td>
<td width="102">22–42 d</td>
</tr>
<tr>
<td width="114">Corn</td>
<td width="102">51.00</td>
<td width="102">55.60</td>
<td width="102">53.00</td>
<td width="102">57.58</td>
<td width="102">53.20</td>
<td width="102">57.80</td>
</tr>
<tr>
<td width="114">Soybean meal</td>
<td width="102">38.55</td>
<td width="102">33.20</td>
<td width="102">35.80</td>
<td width="102">30.45</td>
<td width="102">35.60</td>
<td width="102">30.20</td>
</tr>
<tr>
<td width="114">Soybean oil</td>
<td width="102">6.50</td>
<td width="102">7.50</td>
<td width="102">6.50</td>
<td width="102">7.50</td>
<td width="102">6.50</td>
<td width="102">7.50</td>
</tr>
<tr>
<td width="114">CaCO₃ (Limestone)</td>
<td width="102">1.00</td>
<td width="102">1.00</td>
<td width="102">1.00</td>
<td width="102">1.00</td>
<td width="102">1.00</td>
<td width="102">1.00</td>
</tr>
<tr>
<td width="114">CaHPO₄ (Dicalcium phosphate)</td>
<td width="102">1.70</td>
<td width="102">1.50</td>
<td width="102">1.70</td>
<td width="102">1.50</td>
<td width="102">1.70</td>
<td width="102">1.50</td>
</tr>
<tr>
<td width="114">L-Lysine</td>
<td width="102">0.20</td>
<td width="102">0.20</td>
<td width="102">0.20</td>
<td width="102">0.20</td>
<td width="102">0.29</td>
<td width="102">0.30</td>
</tr>
<tr>
<td width="114">DL-Methionine</td>
<td width="102">0.35</td>
<td width="102">0.32</td>
<td width="102">0.35</td>
<td width="102">0.32</td>
<td width="102">0.38</td>
<td width="102">0.34</td>
</tr>
<tr>
<td width="114">L-Threonine</td>
<td width="102">0.10</td>
<td width="102">0.10</td>
<td width="102">0.10</td>
<td width="102">0.10</td>
<td width="102">0.15</td>
<td width="102">0.15</td>
</tr>
<tr>
<td width="114">NaCl</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
</tr>
<tr>
<td width="114">Zeolite powder</td>
<td width="102">&#8211;</td>
<td width="102">&#8211;</td>
<td width="102">0.75</td>
<td width="102">0.75</td>
<td width="102">0.60</td>
<td width="102">0.61</td>
</tr>
<tr>
<td width="114">Premix¹</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
<td width="102">0.30</td>
</tr>
<tr>
<td width="114">Total</td>
<td width="102">100</td>
<td width="102">100</td>
<td width="102">100</td>
<td width="102">100</td>
<td width="102">100</td>
<td width="102">100</td>
</tr>
</tbody>
</table>
<table>
<tbody>
<tr>
<td rowspan="2" width="102"><strong>Nutrient Levels <sup>2</sup></strong></td>
<td colspan="2" width="205"><strong>Basal Diet</strong></td>
<td colspan="2" width="205"><strong>Low-Protein Diet</strong></td>
<td colspan="2" width="205"><strong>Low-Protein + Amino Acid Diet</strong></td>
</tr>
<tr>
<td width="102">1–21 d</td>
<td width="102">22–42 d</td>
<td width="102">1–21 d</td>
<td width="102">22–42 d</td>
<td width="102">1–21 d</td>
<td width="102">22–42 d</td>
</tr>
<tr>
<td width="102">ME (MJ/kg)</td>
<td width="102">13.00</td>
<td width="102">13.43</td>
<td width="102">13.00</td>
<td width="102">13.43</td>
<td width="102">13.00</td>
<td width="102">13.43</td>
</tr>
<tr>
<td width="102">CP (%)</td>
<td width="102">21.58</td>
<td width="102">19.57</td>
<td width="102">20.53</td>
<td width="102">18.51</td>
<td width="102">20.57</td>
<td width="102">18.56</td>
</tr>
<tr>
<td width="102">Ca (%)</td>
<td width="102">1.03</td>
<td width="102">0.95</td>
<td width="102">1.02</td>
<td width="102">0.94</td>
<td width="102">1.02</td>
<td width="102">0.94</td>
</tr>
<tr>
<td width="102">Available P (%)</td>
<td width="102">0.45</td>
<td width="102">0.41</td>
<td width="102">0.45</td>
<td width="102">0.40</td>
<td width="102">0.45</td>
<td width="102">0.40</td>
</tr>
<tr>
<td width="102">Lys (%)</td>
<td width="102">1.31</td>
<td width="102">1.18</td>
<td width="102">1.24</td>
<td width="102">1.11</td>
<td width="102">1.31</td>
<td width="102">1.18</td>
</tr>
<tr>
<td width="102">Met (%)</td>
<td width="102">0.66</td>
<td width="102">0.61</td>
<td width="102">0.65</td>
<td width="102">0.59</td>
<td width="102">0.66</td>
<td width="102">0.61</td>
</tr>
<tr>
<td width="102">Thr (%)</td>
<td width="102">0.91</td>
<td width="102">0.83</td>
<td width="102">0.86</td>
<td width="102">0.79</td>
<td width="102">0.91</td>
<td width="102">0.83</td>
</tr>
</tbody>
</table>
<p>¹ Premix provided vitamins and minerals.</p>
<p>² Nutrient levels are calculated values.</p>
<p>3.2 Feeding Management<br />
Broilers were reared in a fully enclosed, three-tier caging system. The experimental period was divided into the starter phase (days 1–21) and grower phase (days 22–42). Birds had free access to feed and water under 24 h continuous lighting. Immunization and daily management were conducted according to standard commercial practices.<br />
Feeding period: August 3, 2022 – September 13, 2022.</p>
<p>3.3 Measured Parameters and Methods<br />
(1) Growth Performance<br />
Body weight and residual feed were recorded on days 0, 21, and 42 by replicate, and mortality was documented daily. The following indicators were calculated for the starter (1–21 d), grower (22–42 d), and entire (1–42 d) periods: average body weight (BW), average daily gain (ADG), average daily feed intake (ADFI), and feed conversion ratio (FCR).<br />
&#8211; Without mortality:<br />
ADG = (Final BW – Initial BW) / (Number of birds × Days)<br />
ADFI = Total feed intake / (Number of birds × Days)<br />
FCR = Total feed intake / Total weight gain<br />
&#8211; With mortality:<br />
ADG = (Final BW – Initial BW) / (Number of birds × Days)<br />
*Mortality-affected individuals were excluded from ADG calculation.*<br />
ADFI = (Feed offered – Residual feed – Feed consumed by dead birds) / (Number of surviving birds × Days)<br />
*Feed consumed by dead birds = (Feed offered up to the day of death – Residual feed on the day of death) ÷ (Dead birds + Surviving birds at that time).*</p>
<p>(2) Slaughter Performance and Meat Quality<br />
Chickens were euthanized by jugular vein bleeding. Slaughter performance indices were determined according to the Chinese Agricultural Industry Standard NY/T 823—2004 Poultry Production Performance Terminology and Statistical Methods.<br />
&#8211; Slaughter performance indices included carcass weight, eviscerated weight (half-clean and fully clean weight), abdominal fat weight, Pectoral muscle weight, and leg muscle weight.<br />
&#8211; Meat quality indices included pH values, meat color (L*, a*, b*), pressing loss, and shear force.</p>
<p><strong><b>pH values:</b></strong> Measured using a PH-STAR direct-reading pH meter at three points (anterior, middle, posterior) of the Pectoral muscle at 45 min postmortem (pH45min). Samples were then sealed in PE plastic bags and stored at 4 °C for 24 h, after which pH24h values were determined.</p>
<p><em><i>Meat color (L, a</i></em>, b*):** Determined with a colorimeter at three points (anterior, middle, posterior) of the muscle.</p>
<p><strong><b>Pressing loss:</b></strong> Within 30 min postmortem, approximately 1 g of muscle sample (1.0 cm thick) was weighed (w1), placed between 18 layers of medium-speed filter paper on each side, and subjected to 90 N pressure on a compression platform for 5 min. The sample was then removed and reweighed (w2).</p>
<p><strong><b>Shear force:</b></strong> Within 30 min postmortem, 3–5 samples (~2 g each, ≥6 cm × 3 cm × 3 cm) were collected from each bird, with tendons and fat removed. Measurements were conducted using a tenderness meter according to the manufacturer’s instructions, and mean values were expressed in Newtons (N).</p>
<p><strong><b>Definitions of weights:</b></strong></p>
<p><strong><b>Live weight:</b></strong> Body weight after 12 h fasting before slaughter.</p>
<p><strong><b>Carcass weight:</b></strong> Weight after complete exsanguination and defeathering; water was completely drained after wet-plucking before weighing.</p>
<p><strong><b>Half-</b></strong><strong><b>clean</b></strong><strong><b> weight:</b></strong> Carcass weight after removal of trachea, esophagus, crop, intestines, spleen, pancreas, gallbladder, and reproductive organs, while retaining the heart, liver, lungs, kidneys, proventriculus, gizzard (without cuticle and contents), and abdominal fat (including abdominal fat pad and fat surrounding the gizzard).</p>
<p><strong><b>Fully </b></strong><strong><b>clean</b></strong><strong><b> weight:</b></strong> Half-clean weight after removal of the heart, liver, proventriculus, gizzard, abdominal fat, head, and feet.</p>
<p><strong><b>Abdominal fat weight:</b></strong> Weight of fat dissected from the abdominal cavity and around the gizzard.</p>
<p><strong><b>Pectoral muscle</b></strong><strong><b> weight (left side):</b></strong> The left pectoral muscle (pectoralis major, pectoralis minor, and supracoracoideus) was separated from the sternum along the keel line and weighed.</p>
<p><strong><b>Leg muscle weight (left side):</b></strong> The left thigh and drumstick muscles were dissected by cutting along the dorsal midline from the last thoracic vertebra to the tail, then separating skin along the abdominal and thigh regions, dislocating the hip joint, and removing the entire leg. Thigh and drumstick muscles were then stripped and weighed.</p>
<p><strong><b>Slaughter ratios:</b></strong></p>
<p>Slaughter rate (%) = (Carcass weight ÷ Live weight) × 100</p>
<p>Half-clean rate (%) = (Half-clean weight ÷ Live weight) × 100</p>
<p>Fully clean rate (%) = (Fully clean weight ÷ Live weight) × 100</p>
<p>Pectoral muscle yield (%) = (Pectoral muscle weight ÷ Fully clean weight) × 100</p>
<p>Leg muscle yield (%) = (Leg muscle weight ÷ Fully clean weight) × 100</p>
<p>Abdominal fat rate (%) = (Abdominal fat weight ÷ (Fully clean weight + Abdominal fat weight)) × 100</p>
<p>Pressing loss (%) = [(w1 – w2) ÷ w1] × 100%</p>
<p>(3) Morbidity<br />
Morbidity (%) = (Number of diseased birds ÷ Total birds per group) × 100</p>
<p>(4) Mortality<br />
Mortality (%) = (Number of dead birds ÷ Total birds per group) × 100</p>
<p>(5) Uniformity<br />
Uniformity: = (Number of chickens within ±10% of the average weight) / Total number of weighed chickens × 100%</p>
<p>Note: For large groups, weight sampling is performed on 1% of the chickens, and for small groups, it is performed on 5%, but the sample size should not be fewer than 30-50 chickens.</p>
<p>(6) European Production Index (EPI)<br />
EPI = (Survival rate % × Market BW, kg) ÷ (FCR × Rearing days)</p>
<p>3.4 Data Analysis<br />
The experimental data were initially organized using Excel software, and one-way ANOVA was performed using SPSS 20.0 software to analyze the inter-group differences.</p>
<p>Data are expressed as mean ± standard deviation, with P &lt; 0.05 considered statistically significant, and 0.05 &lt; P &lt; 0.1 considered a trend of difference.</p>
<h2><strong><b>Results and Analysis</b></strong></h2>
<p>4.1 Effects of Sanguinol in Low-Protein Diets on Growth Performance<br />
As shown in Table 3, compared with the CN group, there were no significant differences (P &gt; 0.05) in ADG, ADFI, and FCR among LPB300, LPB500, LPAA, and LPAAB300 groups. Final BW in all treatment groups was higher than CN, and FCR in the grower phase was lower than CN.</p>
<h3><strong><b>Table 3: Effects of Low-Protein Diet with Sanguinol on Broiler Chicken Growth Performance</b></strong></h3>
<table>
<tbody>
<tr>
<td width="87"><strong>Item</strong></td>
<td width="119"><strong>CN</strong></td>
<td width="119"><strong>LPB300</strong></td>
<td width="119"><strong>LPB500</strong></td>
<td width="119"><strong>LPAA</strong></td>
<td width="119"><strong>LPAAB300</strong></td>
<td width="52"><strong>P Value</strong></td>
</tr>
<tr>
<td width="87">Phase (1-21 days)</td>
<td colspan="6" width="650"></td>
</tr>
<tr>
<td width="87">Initial Weight (g)</td>
<td width="119">41.40±0.40</td>
<td width="119">41.63±0.43</td>
<td width="119">41.64±0.52</td>
<td width="119">41.49±0.84</td>
<td width="119">41.50±0.54</td>
<td width="52">0.515</td>
</tr>
<tr>
<td width="87">End Weight (g)</td>
<td width="119">704.90±51.18</td>
<td width="119">710.48±24.93</td>
<td width="119">732.00±60.52</td>
<td width="119">707.40±58.13</td>
<td width="119">718.20±44.16</td>
<td width="52">0.389</td>
</tr>
<tr>
<td width="87">Daily Gain (g)</td>
<td width="119">31.60±4.23</td>
<td width="119">31.85±3.40</td>
<td width="119">32.88±2.89</td>
<td width="119">31.71±2.76</td>
<td width="119">32.22±2.11</td>
<td width="52">0.386</td>
</tr>
<tr>
<td width="87">Daily Feed Intake (g/d)</td>
<td width="119">37.63±2.37</td>
<td width="119">40.26±2.24</td>
<td width="119">40.93±3.43</td>
<td width="119">40.14±3.74</td>
<td width="119">39.49±2.27</td>
<td width="52">0.147</td>
</tr>
<tr>
<td width="87">FCR</td>
<td width="119">1.19±0.05</td>
<td width="119">1.26±0.06</td>
<td width="119">1.25±0.12</td>
<td width="119">1.28±0.17</td>
<td width="119">1.23±0.10</td>
<td width="52">0.142</td>
</tr>
<tr>
<td width="87"></td>
<td width="119"><strong>CN</strong></td>
<td width="119"><strong>LPB300</strong></td>
<td width="119"><strong>LPB500</strong></td>
<td width="119"><strong>LPAA</strong></td>
<td width="119"><strong>LPAAB300</strong></td>
<td width="52"><strong>P Value</strong></td>
</tr>
<tr>
<td width="87">Phase (22-42 days)</td>
<td colspan="6" width="650"></td>
</tr>
<tr>
<td>End Weight (g)</td>
<td>2372.16±260.46</td>
<td>2378.19±253.13</td>
<td>2452.76±300.49</td>
<td>2436.04±256.42</td>
<td>2421.94±303.61</td>
<td>0.975</td>
</tr>
<tr>
<td>Daily Gain (g)</td>
<td>79.41±13.28</td>
<td>79.43±11.65</td>
<td>81.91±11.72</td>
<td>82.35±12.07</td>
<td>81.13±11.70</td>
<td>0.987</td>
</tr>
<tr>
<td>Daily Feed Intake (g/d)</td>
<td>142.03±9.89</td>
<td>134.71±4.69</td>
<td>141.94±5.31</td>
<td>136.67±8.43</td>
<td>138.56±5.66</td>
<td>0.096</td>
</tr>
<tr>
<td>FCR</td>
<td>1.85±0.39</td>
<td>1.74±0.30</td>
<td>1.78±0.28</td>
<td>1.69±0.28</td>
<td>1.72±0.26</td>
<td>0.823</p>
<p>&nbsp;</td>
</tr>
<tr>
<td></td>
<td><strong>CN</strong></td>
<td><strong>LPB300</strong></td>
<td><strong>LPB500</strong></td>
<td><strong>LPAA</strong></td>
<td><strong>LPAAB300</strong></td>
<td><strong>P Value</strong></td>
</tr>
<tr>
<td>Whole Period (1-42 days)</td>
<td colspan="6" width="650"></td>
</tr>
<tr>
<td>Daily Gain (g)</td>
<td>57.69±6.21</td>
<td>55.52±6.03</td>
<td>57.61±7.17</td>
<td>57.21±6.10</td>
<td>57.28±7.24</td>
<td>0.975</td>
</tr>
<tr>
<td>Daily Feed Intake (g/d)</td>
<td>90.13±4.83</td>
<td>87.51±3.29</td>
<td>91.43±3.99</td>
<td>88.38±5.59</td>
<td>88.92±4.95</td>
<td>0.236</td>
</tr>
<tr>
<td>FCR</td>
<td>1.57±0.17</td>
<td>1.59±0.18</td>
<td>1.61±0.22</td>
<td>1.56±0.17</td>
<td>1.57±0.18</td>
<td>0.853</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<p>4.2 Effects of Sanguinol in Low-Protein Diets on Slaughter Performance<br />
As shown in Table 4, supplementation with Sanguinol in low-protein diets increased slaughter rate and half-dressed yield. Compared with CN, no significant differences (P &gt; 0.05) were observed among LPB300, LPB500, LPAA, and LPAAB300 groups in slaughter rate, half-dressed rate, fully dressed rate, Pectoral muscle yield, leg muscle yield, or abdominal fat rate. However, all supplemented groups showed higher slaughter rates than CN.</p>
<h3><strong><b>Table 4: Effects of Low-Protein Diet with Sanguinol on Broiler Chicken Slaughter Performance</b></strong></h3>
<table>
<tbody>
<tr>
<td width="105"><strong>Item</strong></td>
<td width="106"><strong>CN</strong></td>
<td width="106"><strong>LPB300</strong></td>
<td width="106"><strong>LPB500</strong></td>
<td width="106"><strong>LPAA</strong></td>
<td width="106"><strong>LPAAB300</strong></td>
<td width="98"><strong>P Value</strong></td>
</tr>
<tr>
<td width="105">Carcass Yield (%)</td>
<td width="106">87.35±1.86</td>
<td width="106">88.45±1.83</td>
<td width="106">87.93±1.58</td>
<td width="106">89.03±2.36</td>
<td width="106">88.30±3.47</td>
<td width="98">0.827</td>
</tr>
<tr>
<td width="105">Half Clean Yield (%)</td>
<td width="106">81.97±1.38</td>
<td width="106">82.05±1.72</td>
<td width="106">81.52±1.62</td>
<td width="106">82.55±1.98</td>
<td width="106">82.61±3.78</td>
<td width="98">0.800</td>
</tr>
<tr>
<td width="105">Full Clean Yield (%)</td>
<td width="106">71.34±1.11</td>
<td width="106">70.82±0.86</td>
<td width="106">70.35±1.77</td>
<td width="106">71.45±2.53</td>
<td width="106">71.01±2.50</td>
<td width="98">0.568</td>
</tr>
<tr>
<td width="105">Pectoral muscle yield  (%)</td>
<td width="106">28.67±2.80</td>
<td width="106">25.74±2.22</td>
<td width="106">26.30±2.00</td>
<td width="106">27.13±3.72</td>
<td width="106">28.10±2.11</td>
<td width="98">0.344</td>
</tr>
<tr>
<td width="105">Leg muscle yield (%)</td>
<td width="106">19.90±2.80</td>
<td width="106">19.91±0.43</td>
<td width="106">18.53±1.75</td>
<td width="106">18.82±0.99</td>
<td width="106">18.92±0.73</td>
<td width="98">0.077</td>
</tr>
<tr>
<td width="105">Abdominal fat yield (%)</td>
<td width="106">1.36±0.82</td>
<td width="106">1.91±0.29</td>
<td width="106">1.27±0.81</td>
<td width="106">1.55±0.56</td>
<td width="106">1.65±0.58</td>
<td width="98">0.474</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<p>4.3 Effects of Sanguinol in Low-Protein Diets on Meat Quality<br />
As shown in Table 5, supplementation with Sanguinol and amino acids improved meat quality. Compared with CN:<br />
&#8211; Pectoral muscle yellowness (b*) was extremely significantly increased in LPB300, LPB500, and LPAAB300 (P &lt; 0.01), and significantly increased in LPAA (P &lt; 0.05).<br />
&#8211; Pectoral muscle pH45min was significantly decreased in LPB300 (P &lt; 0.05).<br />
&#8211; Shear force was significantly reduced in LPB500, LPAA, and LPAAB300 (P &lt; 0.05).<br />
&#8211; Leg muscle lightness (L*) was significantly increased in LPAA and LPAAB300 (P &lt; 0.05).</p>
<h3><strong><b>Table 5: Effects of Low-Protein Diet with Sanguinol on Broiler Chicken Meat Quality</b></strong></h3>
<p>L* (Leg muscle lightness) a* (Redness) b* (Pectoral muscle yellowness)</p>
<table>
<tbody>
<tr>
<td width="89"></td>
<td width="71"><strong>Item</strong></td>
<td width="119"><strong>CN</strong></td>
<td width="104"><strong>LPB300</strong></td>
<td width="104"><strong>LPB500</strong></td>
<td width="97"><strong>LPAA</strong></td>
<td width="96"><strong>LPAAB300</strong></td>
<td width="53"><strong>P Value</strong></td>
</tr>
<tr>
<td rowspan="7" width="89">Pectoral muscle</td>
<td width="71">L*</td>
<td width="119">50.27±3.62</td>
<td width="104">52.25±3.40</td>
<td width="104">51.34±2.09</td>
<td width="97">51.38±2.87</td>
<td width="96">49.79±3.34</td>
<td width="53">0.187</td>
</tr>
<tr>
<td width="71">a*</td>
<td width="119">6.32±1.68</td>
<td width="104">6.93±1.82</td>
<td width="104">6.09±1.00</td>
<td width="97">7.03±1.68</td>
<td width="96">6.97±1.66</td>
<td width="53">0.427</td>
</tr>
<tr>
<td width="71">b*</td>
<td width="119">7.21±1.47c</td>
<td width="104">9.55±1.64a</td>
<td width="104">9.52±1.11a</td>
<td width="97">9.18±1.17ab</td>
<td width="96">9.58±2.25a</td>
<td width="53">&lt;0.01</td>
</tr>
<tr>
<td width="71">pH 45min</td>
<td width="119">6.82±0.27ab</td>
<td width="104">6.65±0.17c</td>
<td width="104">6.67±0.18bc</td>
<td width="97">6.681±0.17abc</td>
<td width="96">676±0.27abc</td>
<td width="53">0.014</td>
</tr>
<tr>
<td width="71">pH 24h</td>
<td width="119">5.93±0.30</td>
<td width="104">5.85±0.14</td>
<td width="104">5.82±0.09</td>
<td width="97">5.90±0.13</td>
<td width="96">5.87±0.09</td>
<td width="53">0.085</td>
</tr>
<tr>
<td width="71">Shear force</td>
<td width="119">21.59±6.46a</td>
<td width="104">19.85±4.67ab</td>
<td width="104">17.99±3.03b</td>
<td width="97">18.17±6.41b</td>
<td width="96">17.86±4.15b</td>
<td width="53">0.044</td>
</tr>
<tr>
<td width="71">Pressing loss(%)</td>
<td width="119">23.73±6.34</td>
<td width="104">24.98±3.18</td>
<td width="104">27.64±14.33</td>
<td width="97">20.25±5.20</td>
<td width="96">20.39±3.13</td>
<td width="53">0.464</td>
</tr>
<tr>
<td width="89"></td>
<td width="71"><strong>Item</strong></td>
<td width="119"><strong>CN</strong></td>
<td width="104"><strong>LPB300</strong></td>
<td width="104"><strong>LPB500</strong></td>
<td width="97"><strong>LPAA</strong></td>
<td width="96"><strong>LPAAB300</strong></td>
<td width="53"><strong>P Value</strong></td>
</tr>
<tr>
<td rowspan="7" width="89">Leg muscle</td>
<td width="71">L*</td>
<td width="119">54.54±4.71b</td>
<td width="104">55.09±5.26b</td>
<td width="104">56.97±4.43ab</td>
<td width="97">58.73±3.54a</td>
<td width="96">58.89±3.87a</td>
<td width="53">0.010</td>
</tr>
<tr>
<td width="71">a*</td>
<td width="119">8.85±2.24</td>
<td width="104">9.47±2.21</td>
<td width="104">8.73±2.59</td>
<td width="97">9.00±2.27</td>
<td width="96">9.11±2.39</td>
<td width="53">0.937</td>
</tr>
<tr>
<td width="71">b*</td>
<td width="119">10.30±2.82</td>
<td width="104">10.49±2.16</td>
<td width="104">10.77±2.22</td>
<td width="97">10.70±3.48</td>
<td width="96">11.54±4.10</td>
<td width="53">0.879</td>
</tr>
<tr>
<td width="71">pH 45min</td>
<td width="119">6.58±0.22</td>
<td width="104">6.52±0.23</td>
<td width="104">6.54±0.19</td>
<td width="97">6.70±0.27</td>
<td width="96">6.59±0.23</td>
<td width="53">0.175</td>
</tr>
<tr>
<td width="71">pH 24h</td>
<td width="119">6.23±0.13</td>
<td width="104">6.26±0.15</td>
<td width="104">6.29±0.18</td>
<td width="97">6.33±0.18</td>
<td width="96">6.23±0.12</td>
<td width="53">0.147</td>
</tr>
<tr>
<td width="71">Shear force</td>
<td width="119">23.49±5.99</td>
<td width="104">20.62±5.01</td>
<td width="104">24.55±6.75</td>
<td width="97">24.04±5.51</td>
<td width="96">20.78±5.99</td>
<td width="53">0.063</td>
</tr>
<tr>
<td width="71">Pressing loss (%)</td>
<td width="119">26.41±6.80</td>
<td width="104">30.06±5.99</td>
<td width="104">24.29±4.66</td>
<td width="97">24.22±6.81</td>
<td width="96">27.46±9.02</td>
<td width="53">0.345</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<p>4.4 Effects of Sanguinol in Low-Protein Diets on Organ Indices<br />
Compared with CN, no significant differences (P &gt; 0.05) were observed among LP, LPB300, LPB500, LPAA, and LPAAB300 groups in heart, liver, spleen, lung, or kidney indices (Table 6).</p>
<h3><strong><b>Table 6: Effects of Low-Protein Diet with Sanguinol on Organ Index of Broiler Chicken</b></strong></h3>
<table>
<tbody>
<tr>
<td width="102"><strong>Item</strong></td>
<td width="102"><strong>CN</strong></td>
<td width="102"><strong>LPB300</strong></td>
<td width="102"><strong>LPB500</strong></td>
<td width="102"><strong>LPAA</strong></td>
<td width="102"><strong>LPAAB300</strong></td>
<td width="102"><strong>P Value</strong></td>
</tr>
<tr>
<td width="102">Heart</td>
<td width="102">0.32±0.05</td>
<td width="102">0.33±0.03</td>
<td width="102">0.32±0.04</td>
<td width="102">0.33±0.05</td>
<td width="102">0.33±0.03</td>
<td width="102">0.776</td>
</tr>
<tr>
<td width="102">Liver</td>
<td width="102">1.62±0.15</td>
<td width="102">1.67±0.23</td>
<td width="102">1.53±0.13</td>
<td width="102">1.57±0.08</td>
<td width="102">3.56±4.55</td>
<td width="102">0.386</td>
</tr>
<tr>
<td width="102">Spleen</td>
<td width="102">0.11±0.02</td>
<td width="102">0.20±0.13</td>
<td width="102">0.12±0.07</td>
<td width="102">0.16±0.12</td>
<td width="102">0.13±0.03</td>
<td width="102">0.423</td>
</tr>
<tr>
<td width="102">Lung</td>
<td width="102">0.41±0.12</td>
<td width="102">0.38±0.04</td>
<td width="102">0.36±0.05</td>
<td width="102">0.37±0.06</td>
<td width="102">0.35±0.07</td>
<td width="102">0.401</td>
</tr>
<tr>
<td width="102">Kidney</td>
<td width="102">0.48±0.08</td>
<td width="102">0.50±0.08</td>
<td width="102">0.50±0.04</td>
<td width="102">0.49±0.06</td>
<td width="102">0.50±0.10</td>
<td width="102">0.539</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<p>4.5 Effects of Sanguinol in Low-Protein Diets on Mortality<br />
As shown in Table 7, supplementation with Sanguinol significantly reduced mortality. Mortality rates in LPB300, LPB500, LPAA, and LPAAB300 were all significantly lower than CN.</p>
<h3><strong><b>Table 7: Effects of Low-Protein Diet with Sanguinol on Broiler Chicken Mortality Rate</b></strong></h3>
<table>
<tbody>
<tr>
<td width="102"><strong>Item</strong></td>
<td width="102"><strong>CN</strong></td>
<td width="102"><strong>LPB300</strong></td>
<td width="102"><strong>LPB500</strong></td>
<td width="102"><strong>LPAA</strong></td>
<td width="102"><strong>LPAAB300</strong></td>
<td width="102"><strong>P</strong></td>
</tr>
<tr>
<td width="102">Mortality Rate</td>
<td width="102">8.89±3.52%a</td>
<td width="102">6.00±2.21%a</td>
<td width="102">3.00±2.13%b</td>
<td width="102">7.00±3.34%a</td>
<td width="102">1.00±1.00%b</td>
<td width="102">0.021</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<p>4.6 Effects of Sanguinol in Low-Protein Diets on Uniformity<br />
As shown in Table 8, supplementation with Sanguinol improved flock uniformity. Compared with CN, all supplemented groups showed improved uniformity, with LPB500 achieving the highest uniformity.</p>
<h3><strong><b>Table 8: Effects of Low-Protein Diet with Sanguinol on Broiler Chicken Uniformity</b></strong></h3>
<table>
<tbody>
<tr>
<td width="120"><strong>Item</strong></td>
<td width="120"><strong>CN</strong></td>
<td width="120"><strong>LPB300</strong></td>
<td width="120"><strong>LPB500</strong></td>
<td width="120"><strong>LPAA</strong></td>
<td width="120"><strong>LPAAB300</strong></td>
</tr>
<tr>
<td width="120">Uniformity</td>
<td width="120">82.84%</td>
<td width="120">87.20%</td>
<td width="120">87.50%</td>
<td width="120">85.67%</td>
<td width="120">83.78%</td>
</tr>
</tbody>
</table>
<p>4.7 Effects of Sanguinol in Low-Protein Diets on EPI<br />
As shown in Table 9, supplementation with Sanguinol improved EPI. Compared with CN, all supplemented groups showed higher EPI, with LPAAB300 achieving the highest, followed by LPB500.</p>
<h3><strong><b>Table 9: Effects of Low-Protein Diet with Sanguinol on Broiler Chicken European Efficiency Index</b></strong></h3>
<table>
<tbody>
<tr>
<td width="120"><strong>Item</strong></td>
<td width="120"><strong>CN</strong></td>
<td width="120"><strong>LPB300</strong></td>
<td width="120"><strong>LPB500</strong></td>
<td width="120"><strong>LPAA</strong></td>
<td width="120"><strong>LPAAB300</strong></td>
</tr>
<tr>
<td width="120">EPI</td>
<td width="120">348.19</td>
<td width="120">340.15</td>
<td width="120">365.27</td>
<td width="120">355.82</td>
<td width="120">374.60</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<h2><strong><b>Conclusion</b></strong></h2>
<p>Supplementation with Sanguinol in low-protein diets improved growth performance, slaughter performance, meat quality, mortality, uniformity, and EPI in AA broilers. Reducing dietary CP by 1% and supplementing with 300–500 g/mt Sanguinol (0.15% sanguinarine hplc) had no negative impact on production performance, and improved meat quality, uniformity, and EPI while reducing mortality.</p>
<h3><strong><b>Table: Effects of Low-Protein Diet with Sanguinol on Feed Cost and Cost per Unit Weight Gain</b></strong></h3>
<p>This table presents the feed cost and cost per unit weight gain for broiler chickens on a low-protein diet supplemented with Sanguinol.</p>
<table>
<tbody>
<tr>
<td width="120"><strong>Experimental Group</strong></td>
<td width="120"><strong>CN</strong></td>
<td width="120"><strong>LPB300</strong></td>
<td width="120"><strong>LPB500</strong></td>
<td width="120"><strong>LPAA</strong></td>
<td width="120"><strong>LPB300AA</strong></td>
</tr>
<tr>
<td width="120">Early Stage Feed Cost -saving (CNY/mt)</td>
<td width="120">0</td>
<td width="120">-52.75</td>
<td width="120">-38.75</td>
<td width="120">-56.6</td>
<td width="120">-35.6</td>
</tr>
<tr>
<td width="120">Late Stage Feed Cost-saving  (CNY/mt)</td>
<td width="120">0</td>
<td width="120">-53.18</td>
<td width="120">-39.18</td>
<td width="120">-59.81</td>
<td width="120">-24.81</td>
</tr>
</tbody>
</table>
<p>&nbsp;</p>
<p>Economic analysis (soybean meal price: 5000 CNY/mt; corn price: 3000 CNY/mt):<br />
1. Early Stage diet formulation: Supplementation with Sanguinol at 300 g/mt reduced feed cost by 52.75 CNY.<br />
2. Late Stage diet formulation: Supplementation with Sanguinol at 300 g/mt reduced feed cost by 53.18 CNY.</p>
<p>Therefore, supplementation with Sanguinol in low-protein diets not only reduces feed cost but also improves broiler production performance.</p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Invitation to China Feed Industry Exhibition-Qingdao Feed Exhibition 2025</title>
		<link>https://www.phiphar.com/invitation-to-china-feed-industry-exhibition-qingdao-feed-exhibition-2025/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Thu, 10 Apr 2025 04:43:12 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=1066</guid>

					<description><![CDATA[第益肽®Youtide， Sanguinol® Antibiotic-free Feed Pioneer.]]></description>
										<content:encoded><![CDATA[<p><img decoding="async" loading="lazy" class="alignnone size-medium wp-image-1067" src="https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-169x300.png" alt="" width="169" height="300" srcset="https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-169x300.png 169w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-200x356.png 200w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-400x711.png 400w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-576x1024.png 576w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-600x1067.png 600w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-768x1365.png 768w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-800x1422.png 800w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter-864x1536.png 864w, https://www.phiphar.com/wp-content/uploads/2025/04/invitation-letter.png 1080w" sizes="(max-width: 169px) 100vw, 169px" /></p>
<p class="cvGsUA direction-ltr align-center para-style-body"><span class="OYPEnA font-feature-liga-off font-feature-clig-off font-feature-calt-off text-decoration-none text-strikethrough-none">第益肽®Youtide， Sanguinol®</span></p>
<p class="cvGsUA direction-ltr align-center para-style-body"><span class="OYPEnA font-feature-liga-off font-feature-clig-off font-feature-calt-off text-decoration-none text-strikethrough-none">Antibiotic-free Feed Pioneer.</span></p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Effects of Macleaya cordata Water Extract &#8230; Challenged with Escherichia coli</title>
		<link>https://www.phiphar.com/effects-of-macleaya-cordata-water-extract-challenged-with-escherichia-coli/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Sat, 11 Jan 2025 12:41:32 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=1043</guid>

					<description><![CDATA[Effects of Macleaya cordata Water Extract on the Growth Performance, Diarrhea Index, and Intestinal Health of Weaned Piglets Challenged with Escherichia coli Yang Fan, Li Yuying, Tian Junquan, Su Wenxuan, Bao Xuetai, Yao Kang (1.Institute of Subtropical Agriculture, Chinese Academy of Sciences, Key Laboratory of Animal Nutrition Physiology and Metabolism, Hunan Province, Hunan Provincial Research [...]]]></description>
										<content:encoded><![CDATA[<blockquote>
<p style="text-align: center;"><strong>Effects of Macleaya cordata Water Extract on the Growth Performance, Diarrhea Index, and Intestinal Health of Weaned Piglets Challenged with Escherichia coli</strong></p>
</blockquote>
<p style="text-align: center;">Yang Fan, Li Yuying, Tian Junquan, Su Wenxuan, Bao Xuetai, Yao Kang<br />
(1.Institute of Subtropical Agriculture, Chinese Academy of Sciences, Key Laboratory of Animal Nutrition Physiology and Metabolism, Hunan Province, Hunan Provincial Research Center for Healthy Livestock and Poultry Farming, Changsha 410125, China; 2.University of Chinese Academy of Sciences, Beijing 100049, China.)</p>
<p>&nbsp;</p>
<h3><strong>Abstract</strong></h3>
<p>This experiment aimed to investigate the effects of adding <em>Macleaya cordata</em> water extract to the diet on the growth performance, diarrhea index, and intestinal health of weaned piglets challenged with enterotoxigenic <em>Escherichia coli</em> (ETEC). A total of 30 healthy &#8220;Duroc × Landrace × Large White&#8221; weaned piglets (average body weight of 8.22 ± 0.98 kg) at 28 days of age were randomly divided into three groups, with 10 replicates per group and 1 piglet per replicate. The control and model groups were fed a basal diet, while the experimental group received a basal diet supplemented with 1 mL/kg of <em>Macleaya cordata</em> water extract. The pre-experimental period lasted 3 days, and the formal experiment lasted 18 days. On the 15th day of the experiment, the model group and the experimental group were orally administered 10 mL of ETEC K88 bacterial solution (2×10^9 CFU/mL), while the control group received the same dose of sterile LB broth. The results showed:</p>
<ol>
<li>Before the challenge (Days 1–14), the average daily gain (ADG) of weaned piglets in the experimental group was significantly higher (P &lt; 0.05), and the feed-to-gain ratio (F/G) was significantly lower (P &lt; 0.05) compared to the control group. After the challenge (Days 15–18) and throughout the entire experimental period (Days 1–18), no significant differences in growth performance were observed among the groups (P &gt; 0.05).</li>
<li>24 hours after the challenge, the diarrhea index of the model group was significantly higher (P &lt; 0.05) than that of the control group. The experimental group had a lower diarrhea index than the model group, but the difference was not significant (P &gt; 0.05). 48 hours after the challenge, the diarrhea index of the model group was still significantly higher than that of the control group (P &lt; 0.05), while the experimental group had a significantly lower diarrhea index compared to the model group (P &lt; 0.05).</li>
<li>The model group had a significantly deeper jejunal crypt depth and a lower villus-to-crypt ratio (V/C) compared to the control group (P &lt; 0.05). The experimental group showed a significantly higher V/C ratio and a shallower crypt depth in the jejunum (P &lt; 0.05) compared to the model group.</li>
<li>The relative mRNA expression of intestinal pro-inflammatory factors such as IL-1β, IL-17, TNF-α, and IL-8 was significantly higher in the model group compared to the control group (P &lt; 0.05). The experimental group showed significantly lower expression of these inflammatory markers compared to the model group (P &lt; 0.05).</li>
</ol>
<p>In conclusion, the addition of 1 mL/kg <em>Macleaya cordata</em> water extract to the diet improved the growth performance of weaned piglets, alleviated diarrhea, and mitigated the intestinal inflammation and structural damage caused by <em>Escherichia coli</em> infection.</p>
<p><strong>Keywords</strong>: <em>Macleaya cordata</em> water extract, weaned piglets, <em>Escherichia coli</em>, growth performance, diarrhea, intestinal morphology, inflammation</p>
<p><strong><b>Chinese Library Classification Number: </b></strong>S816.7<br />
<strong><b>Document Identification Code:</b></strong> A<br />
<strong><b>Article Number:</b></strong> 1006-267X (2023) 01-0157-11</p>
<h3><strong>Introduction</strong></h3>
<p>The weaning stage is crucial for piglets, and early weaning is one of the key measures to improve the efficiency of modern pig farming systems. However, early weaning can also impose physiological and psychological stress on piglets, resulting in symptoms such as anorexia, intestinal structural and functional damage, diarrhea, and low resistance. At the same time, due to the incomplete development of the digestive and immune systems, weaned piglets under stress are more susceptible to pathogenic bacteria, which can further damage the intestinal structure and function, leading to vomiting, diarrhea, and other symptoms, ultimately threatening piglet health and increasing mortality, causing significant economic losses.</p>
<p>Enterotoxigenic <em>Escherichia coli</em> (ETEC) is one of the main pathogenic factors causing diarrhea in piglets. It can be transmitted through food, water, and feces, posing a severe threat to piglet health. After entering the piglet’s intestines, <em>E. coli</em> multiplies and begins secreting adhesins, which help it colonize the intestinal epithelium, and toxins such as enterotoxins, edema toxins, endotoxins, and hemolysins, which destroy the integrity and function of the intestinal mucosa, leading to diarrhea, vomiting, inflammation, and edema in piglets.</p>
<p>Traditionally, antibiotics have been the primary method to prevent and treat diarrhea in piglets, but research has shown that prolonged antibiotic use can lead to bacterial resistance, drug residues, environmental pollution, and public safety concerns. Furthermore, regulations in China now prohibit feed manufacturers from producing commercial feed containing antibiotic growth promoters. Therefore, finding new, natural, and environmentally friendly alternatives to antibiotics is imperative.</p>
<p><em>Macleaya cordata</em> is a perennial herbaceous plant from the Papaveraceae family, widely distributed in China and several countries in Europe and North America. It is rich in isoquinoline alkaloids, including sanguinarine, chelerythrine, protopine, coptisine, and other compounds. Among them, sanguinarine and chelerythrine are the main active components, which have been shown to promote growth, alleviate inflammation, regulate intestinal flora, enhance immunity, and exhibit antibacterial properties.</p>
<p>Recent studies have reported the antimicrobial and anti-inflammatory properties of sanguinarine and chelerythrine. For example, sanguinarine and chelerythrine have been found to inhibit the growth of pathogenic bacteria like <em>Staphylococcus aureus</em>, <em>Pseudomonas aeruginosa</em>, <em>Escherichia coli</em>, and <em>Streptococcus agalactiae</em>. Sanguinarine also mitigates inflammation by inhibiting the activation of NF-κB-related genes. Furthermore, research on the use of <em>Macleaya cordata</em> extracts in animal production has shown improved growth performance and feed efficiency in weaned piglets, broilers, and calves.</p>
<p>However, the effects of <em>Macleaya cordata</em> water extract on the growth performance, diarrhea, intestinal morphology, and inflammation in piglets infected with <em>E. coli</em> have not been reported. Therefore, this study aims to explore the impact of <em>Macleaya cordata</em> water extract on weaned piglets challenged with ETEC, providing a reference for the application of <em>Macleaya cordata</em> extract in managing diarrhea in weaned piglets.</p>
<h3><strong>1. Materials and Methods</strong></h3>
<h4><strong><b>1.1 Experimental Materials</b></strong></h4>
<p>The <em>Macleaya cordata</em> water extract used in this experiment was self-made from the leaves of <em>Macleaya cordata</em> through crushing, heating, decoction, and concentration. The measured content of sanguinarine was 43.25 μg/mL. The <em>Escherichia coli</em> (ETEC) K88 strain used in this experiment was obtained from the National Center for Strain Preservation (No. VIP(S) 24607), and was prepared by resuscitation and serial propagation to obtain the required concentration of <em>E. coli</em> for the experiment.</p>
<h4><strong><b>1.2 Experimental Design and Management</b></strong></h4>
<p>A total of 30 healthy &#8220;Duroc × Landrace × Large White&#8221; weaned piglets at 28 days of age (average body weight: 8.22 ± 0.98 kg) were randomly assigned to three groups, with 10 replicates per group and 1 piglet per replicate. The three groups were the control group, the model group, and the experimental group. The control and model groups were fed a basal diet, while the experimental group was fed a basal diet supplemented with 1 mL/kg of <em>Macleaya cordata</em> water extract. The basal diet was formulated according to the nutritional standards of NRC (2012), and the composition and nutritional levels of the diet are shown in Table 1. The pre-experimental period lasted for 3 days, and the formal experiment lasted for 18 days. On the 15th day of the experiment, each piglet in the model and experimental groups was orally administered 10 mL of ETEC K88 bacterial solution at a concentration of 2 × 10^9 CFU/mL, while the control group was orally administered an equal volume of sterile LB broth.</p>
<p>This experiment was conducted at the animal facility of the Institute of Subtropical Agriculture, Chinese Academy of Sciences. The experimental site was strictly controlled with closed management. The piglets were housed individually in cages, with free access to feed and water during the experimental period. Regular cleaning and disinfection of the pigpens were carried out.</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1044 size-fusion-400" src="https://www.phiphar.com/wp-content/uploads/2025/01/886A48F5-68FD-4d65-AF7F-3A4EBC113F20-400x617.png" alt="" width="400" height="617" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/886A48F5-68FD-4d65-AF7F-3A4EBC113F20-194x300.png 194w, https://www.phiphar.com/wp-content/uploads/2025/01/886A48F5-68FD-4d65-AF7F-3A4EBC113F20-200x309.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/886A48F5-68FD-4d65-AF7F-3A4EBC113F20-400x617.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/886A48F5-68FD-4d65-AF7F-3A4EBC113F20.png 504w" sizes="(max-width: 400px) 100vw, 400px" /></p>
<p>1) The premix provided the following per kilogram of the basal diet:</p>
<p>VA 12,000 IU,VB1 2.5 mg,VB2 4 mg,VB6 7 mg,VB12 20 mg,VD3 2,000 IU,VE 30 IU,VK3 2.5 mg,Biotin 80.00 μg,Folic acid 0.7 mg,D-pantothenic acid 12.5 mg,Nicotinic acid 40 mg,Cu (as copper sulfate) 6 mg,Fe (as ferrous sulfate) 100 mg,Mn (as manganese sulfate) 20 mg,Zn (as zinc sulfate) 100 mg,I (as potassium iodide) 0.4 mg,Se (as sodium selenite) 0.30 mg.</p>
<p>2) Nutrient levels were calculated values.</p>
<p>&nbsp;</p>
<h4><strong><b>1.3 Sample Collection</b></strong></h4>
<p>On the 18th day of the experiment, the piglets were fasted for 12 hours but allowed free access to water. Then, blood samples were collected from the anterior vena cava, after which the piglets were euthanized, and their intestines (jejunum and ileum) were dissected. The intestinal contents were washed with saline 1–2 times, and the cleaned segments (2–3 cm) were wrapped in aluminum foil and quickly frozen in liquid nitrogen for further analysis.</p>
<h4><strong><b>1.4 Measurement Indicators and Methods</b></strong></h4>
<h5><strong><b>1.4.1 Growth Performance</b></strong></h5>
<p>Daily feed intake was recorded for each piglet. The body weight of each piglet was measured on days 1, 14, and 18 of the experiment to calculate average daily feed intake (ADFI), average daily gain (ADG), and feed conversion ratio (F/G). The calculation formulas were as follows:</p>
<ul>
<li>ADFI = total feed intake / number of experimental days;</li>
<li>ADG = (final body weight &#8211; initial body weight) / number of experimental days;</li>
<li>F/G = ADFI / ADG.</li>
</ul>
<h5><strong><b>1.4.2 Diarrhea Index</b></strong></h5>
<p>Diarrhea was observed and recorded daily at fixed times. Diarrhea severity was scored using a 4-level scale:</p>
<ul>
<li>Normal (solid feces): score 0;</li>
<li>Mild diarrhea (soft, semi-formed feces): score 1;</li>
<li>Moderate diarrhea (semi-liquid feces, high moisture content): score 2;</li>
<li>Severe diarrhea (liquid feces, water separated): score 3.</li>
</ul>
<p>The diarrhea index was calculated as:<br />
Diarrhea index = diarrhea score / total number of piglets.</p>
<h5><strong><b>1.4.3 Intestinal Morphology</b></strong></h5>
<p>Jejunum and ileum tissue samples were fixed in 4% formaldehyde solution, sectioned, and stained for histological examination. Villus height and crypt depth were measured, and the villus-to-crypt ratio (V/C) was calculated.</p>
<h5><strong><b>1.4.4 Intestinal Immune Function</b></strong></h5>
<p>Real-time quantitative PCR was used to measure the relative mRNA expression levels of immune-related genes in the jejunum and ileum, including interleukin-6 (IL-6), interleukin-8 (IL-8), interleukin-1β (IL-1β), interleukin-12β (IL-12β), interleukin-17 (IL-17), interleukin-18 (IL-18), and tumor necrosis factor-α (TNF-α). The specific method was based on Fu et al. [20]. The relative mRNA expression levels of the target genes were calculated using the 2<sup>−ΔΔCt</sup> method, and the primer sequences for the genes are shown in Table 2.</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1045 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片1-800x405.png" alt="" width="800" height="405" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片1-200x101.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1-300x152.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1-400x202.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1-540x272.png 540w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1-600x304.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1-768x389.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1-800x405.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片1.png 824w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<h4><strong><b>1.5 Statistical Analysis</b></strong></h4>
<p>The experimental data were first processed using Excel 2019, followed by one-way ANOVA using SPSS 26.0. Duncan’s multiple range test was used for multiple comparisons. The results are expressed as &#8220;mean ± standard error.&#8221; P &lt; 0.05 was considered statistically significant, and 0.05 &lt; P &lt; 0.10 was considered a significant trend.</p>
<h3><strong>2. Results and Analysis</strong></h3>
<h4><strong><b>2.1 Effects of </b></strong><em>Macleaya cordata</em><strong><b> Water Extract on Growth Performance of Weaned Piglets</b></strong></h4>
<p>Table 3 shows that during days 1–14 (before the challenge), there were no significant differences in final body weight, average daily feed intake (ADFI), and average daily gain (ADG), as well as feed-to-gain ratio (F/G) between the control group and the model group (P &gt; 0.05). However, compared to the control group, the experimental group showed a slight increase in final body weight and ADFI, although the differences were not significant (P &gt; 0.05). The ADG of the experimental group was significantly increased by 33.33% (P &lt; 0.05), and the F/G was significantly reduced by 27.24% (P &lt; 0.05).</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1046 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片2-800x541.png" alt="" width="800" height="541" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片2-200x135.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片2-300x203.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片2-400x271.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片2-600x406.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片2-768x520.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片2-800x541.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片2.png 823w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<p>During days 15–18 (after the challenge), the final body weight, ADFI, and ADG of piglets in the model group were slightly lower than those in the control group, and the F/G was slightly higher, but these differences were not significant (P &gt; 0.05). There were also no significant differences in final body weight, ADG, and F/G between the experimental group and the model group (P &gt; 0.05). Throughout the entire experiment (days 1–18), the final body weight, ADFI, and ADG of piglets in the experimental group were not significantly different from those in the control group (P &gt; 0.05), but there was a trend towards a reduction in F/G (P = 0.089).</p>
<p>&nbsp;</p>
<h3><strong>2.2 Effects of </strong><em>Macleaya cordata</em><strong> Water Extract on the Diarrhea Index of Weaned Piglets</strong></h3>
<p>As shown in Table 4, during days 1–14 (before the challenge), there were no significant differences in the diarrhea index among the three groups (P &gt; 0.05). At 24 hours after the challenge, the diarrhea index of the model group was significantly higher than that of the control group (P &lt; 0.05), while the diarrhea index of the experimental group increased slightly but was not significantly different from the control group (P &gt; 0.05). Compared to the model group, the diarrhea index of the experimental group was slightly lower, but the difference was not significant (P &gt; 0.05).</p>
<p>At 48 hours after the challenge, the diarrhea index of the model group was still significantly higher than that of the control group (P &lt; 0.05). However, compared to the model group, the diarrhea index of the experimental group was significantly lower (P &lt; 0.05).</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1047 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片3-800x180.png" alt="" width="800" height="180" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片3-200x45.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片3-300x68.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片3-400x90.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片3-600x135.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片3-768x173.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片3-800x180.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片3.png 830w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<h3><strong>2.3 Effects of </strong><em>Macleaya cordata</em><strong> Water Extract on the Intestinal Morphology of Weaned Piglets</strong></h3>
<p>From Table 5, it can be seen that, compared to the control group, the jejunal crypt depth of weaned piglets in the model group increased significantly (P &lt; 0.05), while the ileal crypt depth slightly increased but the difference was not significant (P &gt; 0.05). The jejunal villus-to-crypt ratio (V/C) decreased significantly (P &lt; 0.05), but the weight of the jejunum and ileum, as well as the villus height in the jejunum, did not show significant differences (P &gt; 0.05). Compared to the model group, the experimental group had a significantly higher jejunal V/C ratio, ileal villus height, and ileal V/C ratio (P &lt; 0.05), while the jejunal crypt depth was significantly lower (P &lt; 0.05). However, the differences in jejunal weight, villus height, and crypt depth were not significant (P &gt;0.05).</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1048 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片4-800x337.png" alt="" width="800" height="337" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片4-200x84.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片4-300x127.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片4-400x169.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片4-600x253.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片4-768x324.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片4-800x337.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片4.png 818w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1049 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片5-800x383.png" alt="" width="800" height="383" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片5-200x96.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片5-300x144.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片5-400x191.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片5-600x287.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片5-768x368.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片5-800x383.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片5.png 819w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<p>Additionally, as shown in Figure 1, after ETEC infection, the ileal villus height in the model group of weaned piglets decreased, and the jejunal crypt depth increased, with obvious lesions and tissue damage. In contrast, compared to the model group, the experimental group and control group had higher villus heights in both the jejunum and ileum, lower crypt depths, and no visible tissue damage or necrosis.</p>
<h3><strong>2.4 Effects of </strong><em>Macleaya cordata</em><strong> Water Extract on the Intestinal Immune Function of Weaned Piglets</strong></h3>
<p>As shown in Table 6, compared to the control group, the model group had significantly higher relative mRNA expression levels of IL-1β in the jejunum (P &lt; 0.05), while the mRNA expression levels of IL-18, IL-8, and TNF-α in the jejunum were slightly elevated but not significantly different (P &gt; 0.05). Compared to the control group, the experimental group showed slightly lower mRNA expression levels of IL-18, IL-8, and TNF-α in the jejunum, while the relative mRNA expression of IL-1β was slightly increased, but none of these differences were significant (P &gt; 0.05). However, compared to the model group, the experimental group had significantly lower mRNA expression levels of IL-18, IL-8, and IL-1β in the jejunum (P &lt; 0.05), while TNF-α expression was reduced but not significantly (P &gt; 0.05).</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1050 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片6-800x200.png" alt="" width="800" height="200" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片6-200x50.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片6-300x75.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片6-400x100.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片6-600x150.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片6-768x192.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片6-800x200.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片6.png 827w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<p>As shown in Table 7, compared to the control group, the model group had significantly higher mRNA expression levels of IL-17, IL-1β, TNF-α, and IL-8 in the ileum (P &lt; 0.05). In contrast, the experimental group showed reduced mRNA expression levels of IL-17, IL-1β, IL-8, and IL-12β, although these differences were not significant (P &gt; 0.05). Compared to the model group, the experimental group had significantly lower mRNA expression levels of IL-17, IL-1β, TNF-α, and IL-8 in the ileum (P &lt; 0.05), while the mRNA expression of IL-12β was slightly reduced but not significantly different (P &gt; 0.05).</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-1051 size-fusion-800" src="https://www.phiphar.com/wp-content/uploads/2025/01/图片7-800x216.png" alt="" width="800" height="216" srcset="https://www.phiphar.com/wp-content/uploads/2025/01/图片7-200x54.png 200w, https://www.phiphar.com/wp-content/uploads/2025/01/图片7-300x81.png 300w, https://www.phiphar.com/wp-content/uploads/2025/01/图片7-400x108.png 400w, https://www.phiphar.com/wp-content/uploads/2025/01/图片7-600x162.png 600w, https://www.phiphar.com/wp-content/uploads/2025/01/图片7-768x207.png 768w, https://www.phiphar.com/wp-content/uploads/2025/01/图片7-800x216.png 800w, https://www.phiphar.com/wp-content/uploads/2025/01/图片7.png 827w" sizes="(max-width: 800px) 100vw, 800px" /></p>
<h3><strong>3. Discussion</strong></h3>
<h4><strong><b>3.1 Effects of </b></strong><em>Macleaya cordata</em><strong><b> Water Extract on the Growth Performance of Weaned Piglets</b></strong></h4>
<p>In the early stages of weaning, piglets experience various types of stress, including nutritional, psychological, physiological, and environmental stress, which can negatively affect their feeding habits and gastrointestinal development, leading to diarrhea and impaired digestion and absorption of nutrients. This results in reduced growth performance. In previous studies, <em>Macleaya cordata</em> preparations have demonstrated excellent growth-promoting effects. Wang Min et al. reported that adding 300 mg/kg of <em>Macleaya cordata</em> powder to the diet reduced the feed-to-gain ratio and improved the overall growth performance of piglets. Similarly, adding 50 mg/kg of <em>Macleaya cordata</em> powder to the diet increased the average daily feed intake by 3.96%, increased the average daily gain by 9.08%, and reduced the feed-to-gain ratio by 4.67%.</p>
<p>In this experiment, during days 1–14 (before the challenge), the addition of 1 mL/kg of <em>Macleaya cordata</em> water extract to the diet significantly improved the average daily gain of weaned piglets and significantly reduced the feed-to-gain ratio, which is consistent with previous studies. The <em>Macleaya cordata</em> extract is thought to stimulate intestinal cell differentiation, promote intestinal development, and improve nutrient absorption, which may explain its effects on the growth performance of weaned piglets.</p>
<p>After the challenge, the experimental group showed a trend of improved average daily gain and feed-to-gain ratio compared to the model group, suggesting that <em>Macleaya cordata</em> water extract can mitigate the negative effects of <em>Escherichia coli</em> infection on growth performance. The extract’s ability to inhibit <em>E. coli</em> and reduce diarrhea likely contributed to its growth-promoting effects. Studies have shown that <em>Macleaya cordata</em> extract can inhibit the formation of the bacterial Z-ring, thereby interfering with bacterial division and reducing bacterial reproduction. Additionally, the extract can disrupt the bacterial cell membrane, inactivating the bacteria and reducing toxin production, which helps protect the intestinal structure and improve growth performance.</p>
<p>In summary, adding 1 mL/kg of <em>Macleaya cordata</em> water extract to the diet can improve the growth performance of weaned piglets and alleviate the decline in growth performance caused by <em>E. coli</em> infection.</p>
<h3><strong>3.2 Effects of </strong><em>Macleaya cordata</em><strong> Water Extract on the Diarrhea Index of Weaned Piglets</strong></h3>
<p>After weaning, piglets often experience physiological or pathogenic diarrhea due to the incomplete development of their digestive and immune systems. <em>Escherichia coli</em> K88 is one of the main pathogens causing diarrhea in piglets. Diarrhea can significantly affect piglets&#8217; growth performance, increase their mortality rate, and result in substantial economic losses. Therefore, reducing the incidence of diarrhea is crucial for ensuring the healthy growth of piglets.</p>
<p>Previous studies have demonstrated that <em>Macleaya cordata</em> extract can alleviate diarrhea. For example, a study by Xia Chaodu et al. showed that adding 0.1% <em>Macleaya cordata</em> extract to the diet significantly reduced diarrhea rates in weaned piglets. Similarly, Wang Min et al. found that adding 300 mg/kg of <em>Macleaya cordata</em> powder to the diet significantly reduced diarrhea rates in weaned piglets.</p>
<p>In this experiment, 24 hours after the challenge, the diarrhea index of the model group was significantly higher than that of the control group, indicating that the <em>E. coli</em> infection model was successfully established. At 48 hours post-challenge, the diarrhea index of the experimental group was significantly lower than that of the model group, suggesting that <em>Macleaya cordata</em> water extract alleviated the diarrhea caused by <em>E. coli</em> infection. The anti-diarrheal effect of <em>Macleaya cordata</em> extract may be related to its ability to inhibit pathogenic bacteria and regulate the abundance of beneficial gut flora. This indicates that the extract can inhibit <em>E. coli</em> and protect the intestinal structure, thereby reducing the intestinal damage and diarrhea caused by <em>E. coli</em> infection.</p>
<p>A study by Liu et al. also found that <em>Macleaya cordata</em> extract reduced plasma D-lactate and diamine oxidase levels in growing pigs on day 14, indicating that the extract improved intestinal mucosal development and strengthened the intestinal barrier, thereby reducing diarrhea. Additionally, <em>E. coli</em> infection can trigger intestinal inflammation, which contributes to diarrhea. Sanguinarine, a key component of <em>Macleaya cordata</em> extract, has been shown to alleviate intestinal inflammation by acting on epithelial cells, promoting intestinal health and reducing diarrhea.</p>
<p>In summary, adding 1 mL/kg of <em>Macleaya cordata</em> water extract to the diet can alleviate diarrhea caused by <em>E. coli</em> infection in weaned piglets, likely through its antibacterial properties, protection of the intestinal structure, and reduction of intestinal inflammation.</p>
<h3><strong>3.3 Effects of </strong><em>Macleaya cordata</em><strong> Water Extract on Intestinal Morphology of Weaned Piglets</strong></h3>
<p>The normal structure of the intestine is crucial for maintaining the health and growth of piglets. Weaning stress can damage the intestinal structure, leading to villus atrophy, increased crypt depth, and impaired digestive, absorptive, and barrier functions. In addition, <em>E. coli</em> infection further damages the intestinal structure. Intestinal villus height, crypt depth, and the villus-to-crypt ratio (V/C) are important indicators for evaluating intestinal absorptive function. During normal development, intestinal epithelial cells from the crypt migrate to the villus, where they differentiate and mature, enhancing absorptive capacity. However, <em>E. coli</em> infection disrupts this process.</p>
<p>Chen et al. reported that <em>Macleaya cordata</em> extract significantly reduced crypt depth and increased the V/C ratio in the jejunum of weaned piglets, indicating that the extract can improve intestinal morphology. In this experiment, after the <em>E. coli</em> challenge, compared to the model group, the experimental group showed improved intestinal villus height, reduced crypt depth, and increased V/C ratio in both the jejunum and ileum. These findings suggest that adding <em>Macleaya cordata</em> water extract to the diet can mitigate the intestinal structural damage caused by <em>E. coli</em> infection.</p>
<p>The improvement in intestinal morphology may be due to the extract&#8217;s ability to inhibit pathogenic bacteria, thereby reducing toxin production and alleviating damage to the intestinal structure. Previous studies have shown that <em>Macleaya cordata</em> extract can effectively inhibit harmful intestinal bacteria in broilers, reducing the production of toxic substances and alleviating intestinal damage. Furthermore, <em>Macleaya cordata</em> extract can promote the proliferation and differentiation of intestinal cells, facilitating the repair and regeneration of damaged intestinal structures. In this study, after inactivating <em>E. coli</em>, <em>Macleaya cordata</em> extract likely promoted the regeneration of intestinal cells, helping restore the damaged intestinal structure to normal levels comparable to those in the control group.</p>
<p>In conclusion, adding 1 mL/kg of <em>Macleaya cordata</em> water extract to the diet can improve the intestinal morphology of weaned piglets by alleviating the villus atrophy and crypt hyperplasia caused by <em>E. coli</em> infection.</p>
<h3><strong>3.4 Effects of </strong><em>Macleaya cordata</em><strong> Water Extract on Intestinal Immune Function of Weaned Piglets</strong></h3>
<p><em>Macleaya cordata</em> extract has demonstrated anti-inflammatory properties, which may be attributed to its active components, sanguinarine and chelerythrine. Sanguinarine can inhibit NF-κB activation and reduce the levels of tumor necrosis factor-alpha (TNF-α) and nitric oxide in macrophages, thereby alleviating inflammation. Additionally, both sanguinarine and chelerythrine have been shown to significantly reduce the mRNA expression of monocyte chemoattractant protein-1 (MCP-1) and IL-6 in macrophages, with effects similar to those of the anti-inflammatory drug prednisone.</p>
<p>After <em>E. coli</em> infection, piglet intestines produce toxins that damage the intestinal mucosa and stimulate the synthesis and secretion of pro-inflammatory cytokines, such as IL-6, IL-1β, and TNF-α, disrupting intestinal immune balance and leading to inflammation. The expression levels of inflammatory cytokines reflect the body&#8217;s inflammatory status. While a moderate inflammatory response is necessary for combating pathogens, excessive inflammation can cause tissue damage.</p>
<p>Previous studies have demonstrated the anti-inflammatory effects of <em>Macleaya cordata</em> extract. For example, Gao Huan et al. found that sanguinarine significantly reduced the relative mRNA expression levels of IL-6 and IL-8 in the intestinal mucosal cells of piglets, thereby alleviating inflammation in the intestinal epithelium. Furthermore, <em>Macleaya cordata</em> extract has been shown to reduce intestinal inflammation in broilers by down-regulating the expression of pro-inflammatory cytokines, such as IL-1β. The extract has also been reported to reduce the expression of inflammatory cytokines like macrophage migration inhibitory factor (MIF), IL-8, IL-1β, interferon-gamma (IFN-γ), and TNF-α, while increasing the expression of the anti-inflammatory cytokine IL-10, thereby alleviating rotavirus-induced intestinal inflammation in mice.</p>
<p>In this experiment, <em>E. coli</em> infection significantly increased the mRNA expression levels of IL-18, IL-8, and IL-1β in the jejunum, as well as IL-17, IL-1β, TNF-α, and IL-8 in the ileum of piglets in the model group, indicating the presence of intestinal inflammation. However, the addition of <em>Macleaya cordata</em> water extract significantly reduced the mRNA expression levels of these pro-inflammatory cytokines in both the jejunum and ileum of piglets in the experimental group. These findings suggest that <em>Macleaya cordata</em> water extract can alleviate intestinal inflammation by reducing the expression of pro-inflammatory cytokines such as IL-18, IL-8, IL-1β, IL-17, and TNF-α.</p>
<p>The anti-inflammatory and antibacterial properties of <em>Macleaya cordata</em> extract are likely responsible for its ability to reduce intestinal inflammation. However, the specific mechanisms underlying its anti-inflammatory effects remain unclear and require further investigation.</p>
<p>In conclusion, adding 1 mL/kg of <em>Macleaya cordata</em> water extract to the diet can alleviate the intestinal inflammation caused by <em>E. coli</em> infection in weaned piglets.</p>
<h3><strong>4. Conclusion</strong></h3>
<p>Adding 1 mL/kg of <em>Macleaya cordata</em> water extract to the diet can improve the growth performance of weaned piglets and alleviate the negative effects of <em>Escherichia coli</em> infection, including diarrhea, decreased growth performance, reduced villus height, increased crypt depth, and intestinal inflammation.</p>
<p>&nbsp;</p>
<p><strong><b>Reference</b></strong></p>
<p>&nbsp;</p>
<p>&nbsp;</p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Effects of Youtide on the Production Performance of Weaned Piglets</title>
		<link>https://www.phiphar.com/effects-of-youtide-on-the-production-performance-of-weaned-piglets/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Mon, 22 Jul 2024 12:42:34 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=1016</guid>

					<description><![CDATA[Effects of Youtide on the Production Performance of Weaned Piglets Abstract: In this experiment, 500g/mt Youtide was added into the diet of weaned piglets to investigate the effects of Youtide on the growth performance and diarrhea rate of weaned piglets. The end-day weight and average daily gain increased by 5.0% and 7.47% (P＜0.05), the feed-meat [...]]]></description>
										<content:encoded><![CDATA[<h1><strong><b>Effects of Youtide on the Production Performance of Weaned Piglets</b></strong></h1>
<p><strong>Abstract:</strong> In this experiment, 500g/mt Youtide was added into the diet of weaned piglets to investigate the effects of Youtide on the growth performance and diarrhea rate of weaned piglets. The end-day weight and average daily gain increased by 5.0% and 7.47% (P＜0.05), the feed-meat ratio decreased by 6.1% (P＜0.05), and the <strong>diarrhea rate</strong> decreased by 63.27% (<strong>P＜0.01</strong>). The results showed that adding Youtide to piglet diet could improve the performance of piglets and reduce the rate of diarrhea.</p>
<p><strong>Key words:</strong> Youtide; Piglet; Production performance</p>
<p><strong>Chinese Library Classification Number: S828.5 Document Code: A Article Number: 1007-7731 (2020) 22-</strong></p>
<p>Antimicrobial peptides (AMPs) are natural antibacterial substances widely present in organisms and are an important part of innate immunity. Numerous studies have shown that antimicrobial peptides have functions such as antibacterial, antifungal, antiviral, anti-protozoal, and tumor cell inhibition[1-3]. In this experiment, 500g/mt of Youtide was added to the diet of weaned piglets to explore the effects of Youtide on the production performance and diarrhea rate of weaned piglets, providing a scientific basis for the application of Youtide in piglet feed.</p>
<h3><b>1. </b><strong><b>Materials and</b></strong><strong><b> </b></strong><strong><b>Methods</b></strong></h3>
<p><strong>    </strong><strong>Experimental </strong><strong>Materials</strong></p>
<p><strong> </strong>The Youtide used in this experiment was provided by Guangdong Rongda Biology Co., Ltd. It is an intestinal-derived antimicrobial peptide composed of 42 amino acids,with a molecular weight of 4.7KDa and an α-helix structure.</p>
<h3><b>1.2 </b><strong><b>Experimental Animals and Diet</b></strong></h3>
<p><strong> </strong>The experiment selected DLY (Duroc × Landrace × Yorkshire) weaned piglets. The basal diet was designed according to the NRC (2012) pig nutrition requirements and was in pellet form. The composition and nutritional content of the basal diet are shown in Table 1.</p>
<p><strong>Table 1 Composition and nutrient level of the basal diet ( air-dry basis)</strong></p>
<table style="height: 431px;" width="780">
<tbody>
<tr>
<td width="352">原料</p>
<p>Ingredients</td>
<td width="94">含量%</p>
<p>Content</td>
<td width="196">营养水平 <sup>2</sup>）</p>
<p>Nutrient level</td>
<td colspan="2" width="111">含量%</p>
<p>Content</td>
</tr>
<tr>
<td width="352">玉米 corn</td>
<td width="94">59.3</td>
<td width="196">消化能 DE/（MJ/kg）</td>
<td colspan="2" width="111">14.43</td>
</tr>
<tr>
<td width="352">去皮豆粕 Peeled soybean meal</td>
<td width="94">8.0</td>
<td width="196">粗蛋白质 Crude Protein</td>
<td colspan="2" width="111">19.50</td>
</tr>
<tr>
<td width="352">膨化大豆 Extruded soybeans</td>
<td width="94">6.0</td>
<td width="196">钙 Ca</td>
<td colspan="2" width="111">0.79</td>
</tr>
<tr>
<td width="352">发酵豆粕 Fermented soybean meal</td>
<td width="94">7.0</td>
<td width="196">总磷 Total phosphorus</td>
<td colspan="2" width="111">0.60</td>
</tr>
<tr>
<td width="352">乳清粉 Whey powder</td>
<td width="94">6.0</td>
<td width="197">赖氨酸 Lysine</td>
<td width="111">     1.50</td>
<td width="0"></td>
</tr>
<tr>
<td width="352">鸡血浆蛋白粉 Chicken plasma protein powder</td>
<td width="94">2.5</td>
<td width="197">蛋氨酸 Methionine</td>
<td width="111">     0.52</td>
<td width="0"></td>
</tr>
<tr>
<td width="352">鱼粉 Fish meal</td>
<td width="94">3.0</td>
<td width="197">苏氨酸 Threonine</td>
<td width="111">    0.98</td>
<td width="0"></td>
</tr>
<tr>
<td width="352">豆油 Soybean oil</td>
<td width="94">2.5</td>
<td width="197">色氨酸 Tryptophan</td>
<td width="111">     0.18</td>
<td width="0"></td>
</tr>
<tr>
<td width="352">石粉 Limestone</td>
<td width="94">0.8</td>
<td width="197"></td>
<td width="111"></td>
<td width="0"></td>
</tr>
<tr>
<td width="352">磷酸氢钙 CaHPO<sub>4</sub></td>
<td width="94">0.9</td>
<td width="197"></td>
<td width="111"></td>
<td width="0"></td>
</tr>
<tr>
<td width="352">预混料 Premix<sup>1</sup>）</td>
<td width="94">4.0</td>
<td width="197"></td>
<td width="111"></td>
<td width="0"></td>
</tr>
<tr>
<td width="352">合计 Total</td>
<td width="94">100</td>
<td width="197"></td>
<td width="111"></td>
<td width="0"></td>
</tr>
</tbody>
</table>
<ul>
<li>
<h3><strong><b>2.1 </b></strong><strong><b>Experimental Design and Feeding</b></strong><strong><b> </b></strong><strong><b>Management</b></strong></h3>
<p><strong> </strong>Eighty 28-day-old DLY (Duroc × Landrace × Yorkshire) weaned piglets were selected. They were randomly divided into 2 groups with similar body weights and equal sex ratios, with each group having 4 replicates and 10 piglets per replicate. The control group was fed the basal diet, while the experimental group was fed the basal diet supplemented with 500g/T of Youtide. The pre-trial period was 3 days, and the formal trial period was 39 days. The experiment was conducted on a pig farm in Zhaoqing, Guangdong.</p>
<p>The piglets were housed in a nursery with free access to feed and water and were immunized and dewormed according to the routine management procedures of the pig farm.</p>
<h3><strong><b>2.2 </b></strong><strong><b>Measurement Methods</b></strong></h3>
<p><strong> </strong>On days 1 and 39, the piglets in both the experimental and control groups were weighed on an empty stomach, and their average daily gain (ADG) was calculated. Feed intake and feed residue were recorded by repetition, and the average daily feed intake (ADFI) and feed-to-gain ratio (F/G) of the piglets were calculated.</p>
<p>During the trial, the diarrhea occurrences of piglets in each replicate were observed and recorded daily. The diarrhea rate was calculated as the percentage of piglet-days with diarrhea out of the total piglet-days for each replicate.</p>
<p>Diarrhea rate = (Total diarrhea occurrences) / (Number of piglets × Number of trial days) × 100%</p>
<h3><strong><b>3.1 </b></strong><strong><b>Data</b></strong><strong><b> </b></strong><strong><b>Analysis</b></strong></h3>
<p><strong> </strong>The experimental data were statistically processed using Excel 2007 and analyzed using independent sample t-tests in SPSS19.0 software. The results were expressed as mean ± standard deviation. P&lt;0.05 indicated significant differences, and P&lt;0.01 indicated very significant differences.</p>
<h3><strong><b>3.2 </b></strong><strong><b>Results and</b></strong><strong><b> </b></strong><strong><b>Analysis</b></strong></h3>
<p>As shown in Table 2, compared with the control group, the final weight and average daily gain (ADG) of the experimental group at the end of the 39 days increased by 5.0% and 7.47%, respectively (P&lt;0.05). The feed-to-gain ratio (F/G) decreased by 6.1% (P&lt;0.05), and the diarrhea rate decreased by 63.27% (P&lt;0.01). The results indicate</p>
<p>that adding Youtide to the piglet diet can improve the production performance of piglets and reduce the diarrhea rate.</p>
<p><strong>Table 2 Effects of Antimicrobial Peptides on Growth Performance and Diarrhea Rate of Weaned Piglets</strong></p>
<table>
<tbody>
<tr>
<td style="text-align: center;" width="272"><strong><b>项目</b></strong><strong><b> Items</b></strong></td>
<td style="text-align: center;" colspan="2" width="371"><strong><b>组别</b></strong><strong><b> Group</b></strong></td>
</tr>
<tr>
<td width="272"><strong><b> </b></strong></td>
<td width="152"><strong><b>对照组</b></strong><strong><b> Control</b></strong></td>
<td width="219"><strong><b>试验组</b></strong><strong><b> Experimental</b></strong></td>
</tr>
<tr>
<td width="272">始重 Initial weight /kg</td>
<td width="152">8.09±0.07</td>
<td width="219">8.11±0.09</td>
</tr>
<tr>
<td width="272">末重 Final weight /kg</td>
<td width="152">23.93±0.51b</td>
<td width="219">25.13±0.69a</td>
</tr>
<tr>
<td width="272">平均日采食量 ADFI /g</td>
<td width="152">669.24±19.47</td>
<td width="219">673.91±28.65</td>
</tr>
<tr>
<td width="272">平均日增重 ADG /g</td>
<td width="152">406.15±10.54b</td>
<td width="219">436.47±20.63a</td>
</tr>
<tr>
<td width="272">料重比 F /G</td>
<td width="152">1.64±0.03a</td>
<td width="219">1.54±0.02b</td>
</tr>
<tr>
<td width="272">腹泻率 Diarrhea rate /%</td>
<td width="152">12.58±0.82A</td>
<td width="219">4.62±0.65B</td>
</tr>
</tbody>
</table>
<p>In the same row，values with different small letter superscripts mean significant difference( P＞0.05)， while with the same or noletter superscripts mean no significant difference( <em>P</em>＞0.05).</p>
<h3><strong><b>4.</b></strong><strong><b>Discussion</b></strong></h3>
<p><strong> </strong>Research by Qin Xiaorong et al. (2011), Jiang Wen et al. (2016), and Li Yan et al. (2017) found that adding antimicrobial peptides to the basal diet can increase the average daily gain (ADG) of weaned piglets and reduce the feed-to-gain ratio (F/G)[4-6]. The Youtide used in this experiment is an α-helix structured intestinal antimicrobial peptide. The results showed that Youtide significantly increased the ADG of weaned piglets and significantly reduced the F/G.</p>
<p>Escherichia coli is one of the main causes of piglet diarrhea[7]. Research by Xiao Shan et al. (2017) and Chen Zhanghua et al. (2017) found that antimicrobial peptides can effectively inhibit the proliferation of pathogens such as Escherichia coli[7-9]. By their high-efficiency antibacterial properties, antimicrobial peptides effectively reduce bacterial diarrhea in piglets[10]. This experiment is consistent with the aforementioned studies, finding that Youtide significantly reduced the diarrhea rate in weaned piglets. This may be due to Youtide inhibiting the proliferation of harmful bacteria in the intestines, promoting intestinal microecological balance, and thereby reducing bacterial diarrhea in piglets.</li>
<li>
<h3><strong><b>5. </b></strong><strong><b>Conclusion</b></strong></h3>
<p><strong> </strong></p>
<p>Adding 500g/mt of Youtide to the diet of weaned piglets can significantly improve production performance and significantly reduce the diarrhea rate in piglets.</p>
<p>&nbsp;</p>
<h3><strong><b>REFERENCES</b></strong></h3>
<p>[1] 单安山,马得莹,冯兴军,等.抗菌肽的功能、研发与应用 [J].中国农业科学, 2012, 45(11): 2249-2259.<br />
[2] 梁英.抗菌肽的来源及应用[J].动物营养学报,2014,26(1):7-16.<br />
[3]刘世财,范琳琳,郑珩,等.抗菌肽作用机制及应用研究进展[J].中国生化药物杂志,2016,36(4): 20-28.<br />
[4]覃小荣, 刘丁健, 曾其恒, 等. 抗菌肽对保育猪生产性能与健康水平的影响[J]. 饲料研究,2011(4):6-8.<br />
[5]姜文, 赵鑫, 宋凯等. 抗菌肽与植物精油对断奶仔猪生长性能的影响[J].黑龙江畜牧兽医,2016(8):74-76.<br />
[6]李妍,孙汝江,秦娜,等.日粮中添加多肽菌素对断奶仔猪生产性能和血清生化指标的影响[J].<br />
[7]肖珊,汪乐晴,姚明,等.腹泻仔猪源沙门氏菌、致病性大肠杆菌生物膜形成与耐药的相关性研究[A].中国畜牧兽医学会 2014 年学术年会论文集[C].北京:中国畜牧兽医学会,2014.<br />
[8]陈张华,邓俊良.复合抗菌肽对断奶仔猪肠道菌群和 pH 值的影响[J].畜牧与兽医,2017,49(11):109-113.<br />
[9]刘倚帆,徐良,朱海燕,等.抗菌肽与抗生素对革兰氏阴性菌和革兰氏阳性菌的体外协同抗菌效果研究[J].动物营养学报,2010,22(5):1457-1463.<br />
[10]熊海涛,刘扬科,张志华,董文听,谯仕彦,张 江.无抗日粮中添加肠杆菌肽对仔猪生长性能</li>
</ul>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Waiting friends at ILDEX Vietnam 2024 at A23 stand</title>
		<link>https://www.phiphar.com/waiting-friends-at-ildex-vietnam-2024-at-a23-standard/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Fri, 17 May 2024 07:09:00 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=988</guid>

					<description><![CDATA[]]></description>
										<content:encoded><![CDATA[<p><img decoding="async" loading="lazy" class="size-medium wp-image-1008" src="https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-300x225.jpg" alt="" width="300" height="225" srcset="https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-200x150.jpg 200w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-300x225.jpg 300w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-400x300.jpg 400w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-600x450.jpg 600w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-768x576.jpg 768w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-800x600.jpg 800w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-1024x768.jpg 1024w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-1200x900.jpg 1200w, https://www.phiphar.com/wp-content/uploads/2024/05/Sanguinol-1536x1152.jpg 1536w" sizes="(max-width: 300px) 100vw, 300px" /></p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Attend IPPE 2024 Atlanta</title>
		<link>https://www.phiphar.com/attend-ippe-2024-atlanta/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Mon, 11 Dec 2023 05:33:42 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=983</guid>

					<description><![CDATA[We are going to attend IPPE 2024 Atlanta ,booth No. A411 to start our first oversea journey officially.  We'll be glad to meet friends in animal heath industry and add our value into this field.]]></description>
										<content:encoded><![CDATA[<p>We are going to attend IPPE 2024 Atlanta ,booth No. A411 to start our first oversea journey officially.  We&#8217;ll be glad to meet friends in animal heath industry and add our value into this field.</p>
<p><img decoding="async" loading="lazy" class="alignnone wp-image-984" src="https://www.phiphar.com/wp-content/uploads/2023/12/lxbg_2023_09_30_1b6c731eefdf42648f3e7f0ac34f3554.png" alt="" width="324" height="310" srcset="https://www.phiphar.com/wp-content/uploads/2023/12/lxbg_2023_09_30_1b6c731eefdf42648f3e7f0ac34f3554-200x191.png 200w, https://www.phiphar.com/wp-content/uploads/2023/12/lxbg_2023_09_30_1b6c731eefdf42648f3e7f0ac34f3554.png 300w" sizes="(max-width: 324px) 100vw, 324px" /></p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>Sanguinol</title>
		<link>https://www.phiphar.com/sanguinol/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Wed, 30 Jun 2021 07:14:13 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=929</guid>

					<description><![CDATA[Sanguinol ---macleaya cordata extract, an AGP alternative pioneer What is Sanguinol ? Sanguinol is a light orange powder feed additive derived from the extract of the Papaveraceae plant - macleaya cordata. It has strong antibacterial effect and broad antibacterial spectrum. It has antibacterial activity to coccus, bacillus, G+ &amp; G- bacteria, and it has stronger [...]]]></description>
										<content:encoded><![CDATA[<p><strong>Sanguinol</strong> &#8212;<strong>macleaya cordata extract, </strong>an AGP alternative pioneer</p>
<p><strong><span class="JsGRdQ">What is Sanguinol ?</span></strong></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Sanguinol is a light orange powder feed additive derived from the extract of the Papaveraceae plant &#8211; macleaya cordata.</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">It has strong antibacterial effect and broad antibacterial spectrum.</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">It has antibacterial activity to coccus, bacillus, G+ &amp; G- bacteria, and it has stronger antibacterial activity to some bacteria than the commonly used berberine hydrochloride and penicillin.</span></p>
<p><strong><span class="JsGRdQ">How does it work?</span></strong></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Sanguinol contains Isoquinoline Alkaloids which works as the main active ingredients, in which sanguinarine is most important element.</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Sanguinarine can inhibit the activation of the NF-κB signaling pathway in cells in the organism, reduce the production of inducible nitric oxide, thereby achieve anti-inflammatory effects.</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">It can reduce the expression of inflammatory cytokines caused by a variety of stresses, thereby reducing the level of inflammation in the body. Niu and other studies have shown that sanguinarine can inhibit the activation of the NF-κB signaling pathway in cells in the organism, reduce the production of inducible nitric oxide, and achieve anti-inflammatory effects.</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><strong><span class="JsGRdQ">What are benefits?</span></strong></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Increase feed intake</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Enhance gut health</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Enhance fertility &amp; habitability</span></p>
<p>Promote growth</p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Reduce antibiotics use</span></p>
<p class="_04xlpA direction-ltr align-start para-style-body"><span class="JsGRdQ">Lower FCR</span></p>
<p>&nbsp;</p>
<p>*Available in 500g,1kg,5kg,25kg package .</p>
<p>*Water soluble powder available.</p>
<p>* NO WITHDRAWAL PERIOD.</p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>What can probiotics do?</title>
		<link>https://www.phiphar.com/what-can-probiotics-do/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Sun, 06 Sep 2020 07:15:23 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=912</guid>

					<description><![CDATA[Beneficial healthy intestinal bacterium.  What is probiotics? Probiotics are defined as live microorganisms causing no pathological disorders and promoting enteric microbiota balance (Ohimain and Ofongo, 2012), optimizing function of enteric epithelia and mucosal immunity, which is an important first line of defense against the intrusion of enteric pathogens (Fagarasan, 2006). Its appearance can be [...]]]></description>
										<content:encoded><![CDATA[<div id="attachment_913" style="width: 310px" class="wp-caption alignnone"><img aria-describedby="caption-attachment-913" decoding="async" loading="lazy" class="size-medium wp-image-913" src="https://www.phiphar.com/wp-content/uploads/2020/09/pig-Probiotics-300x183.jpg" alt="" width="300" height="183" srcset="https://www.phiphar.com/wp-content/uploads/2020/09/pig-Probiotics-200x122.jpg 200w, https://www.phiphar.com/wp-content/uploads/2020/09/pig-Probiotics-300x183.jpg 300w, https://www.phiphar.com/wp-content/uploads/2020/09/pig-Probiotics-400x244.jpg 400w, https://www.phiphar.com/wp-content/uploads/2020/09/pig-Probiotics-600x367.jpg 600w, https://www.phiphar.com/wp-content/uploads/2020/09/pig-Probiotics.jpg 720w" sizes="(max-width: 300px) 100vw, 300px" /><p id="caption-attachment-913" class="wp-caption-text">Beneficial healthy intestinal bacterium.</p></div>
<h2><strong><b>What is probiotics?</b></strong></h2>
<p><strong><b>P</b></strong><strong><b>robiotics</b></strong> are defined as live microorganisms causing no pathological disorders and promoting enteric microbiota balance (Ohimain and Ofongo, 2012), optimizing function of enteric epithelia and mucosal immunity, which is an important first line of defense against the intrusion of enteric pathogens (Fagarasan, 2006).</p>
<p>Its appearance can be powder,granule,coated granule,micro-capsule. It can be a single strain, multi-strain, a combination with other ingredients.</p>
<p>Most commercial probiotic products fall into two major categories, Sporulated <em>Bacillus spp.</em> and Lactic acid producing bacteria . Here is an overview of the major probiotic bateria species which consists of the probiotics product.</p>
<table>
<tbody>
<tr>
<td width="223"><em><i>Bacillus</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>B. subtilis, B. licheniformis</i></em></td>
</tr>
<tr>
<td width="223"><em><i>Lactobacillus</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>L. acidophilus, L. bulgaricus, L. reuteri, L. salvarus, L. sobrius</i></em></td>
</tr>
<tr>
<td width="223"><em><i>Enterococcus</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>E. faecium</i></em></td>
</tr>
<tr>
<td width="223"><em><i>Bifidobacterium</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>B. animalis, B. bifidum</i></em></td>
</tr>
<tr>
<td width="223"><em><i>Pediococcus</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>P. acidilactici </i></em></td>
</tr>
<tr>
<td width="223"><em><i>Clostridium</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>C. butyricum</i></em></td>
</tr>
<tr>
<td width="223"><em><i>Streptococcus</i></em><em><i> spp.</i></em></td>
<td width="479"><em><i>S. thermophilus</i></em></td>
</tr>
</tbody>
</table>
<h2><strong><b>Can probiotics </b></strong><strong><b>keep stable in </b></strong><strong><b>heat</b></strong><strong><b> </b></strong><strong><b>treatment?</b></strong></h2>
<p>This is an FAQ by customers whether probiotics can withstand the heat treatments being used in normal feed production practices.</p>
<p>Some probiotic companies claim that sporulated bacteria such as <em><i>Bacillus spp.</i></em> and <em><i>Clostridium spp.</i></em> are less heat sensitive than non-sporulated bacteria such as lactic acid producing bacteria and <em><i>Bifidiobacterium spp.</i></em> This in itself is true, but it is not a complete answer, because:</p>
<p><strong><b>Protection from oxygen sometimes required</b></strong></p>
<p><em><i>Bifidiobacterium spp.</i></em> are obligate anaerobes, meaning they cannot grow in the presence of oxygen, and therefore need to be protected from air in order for them to survive. Certain coating technologies offer protection against the normal heat and steam treatments currently used in feed manufacture, which can have additional stabilizing effects for survivability of obligate anaerobic bacteria. However, these protective coatings need to be adapted to the species, and even the specific strain’s needs, in order to warrant proper protection during the pelleting process.</p>
<p>Probiotics delivered to animals at an early age can help establish a beneficial gut microbiota and set them on the right path for development. Application of probiotics in adult animals also provides benefits including resistance to health challenges and better flock uniformity.</p>
<p><strong><b>Probiotics can be used to address several challenges in commercial</b></strong><strong><b> </b></strong><strong><b>production</b></strong><strong><b> of food-producing animals</b></strong><strong><b>, such as: </b></strong></p>
<ul>
<li>Opportunistic <b></b><strong><b>bacterial challenge</b></strong></li>
<li><b></b><strong><b><em>Salmonella</em></b></strong><b></b><b></b></li>
<li><b></b><strong><b>Heat stress</b></strong></li>
<li><strong><b>Antibiotics reduction</b></strong></li>
</ul>
<h2><strong><b>Bacteria challenge</b></strong></h2>
<p>Bacteria, such as <em>Salmonella, Clostridium, Escherichia coli</em>, and other opportunistic microorganisms have the capability of causing chronic mucosal enteric damage disturbing not only gut integrity but also the overall physiology of the animals.<br />
The outbreak of these microorganisms bring several consequences, such as enteric epithelia cells destruction, decrease on nutrient digestion and absorption capacity (Kaldhusdal et al., 2001). In addition, Salmonella, E. coli and Campylobacter carcass contamination are negative bacteria causing enteric disorders not only in animals but also in humans.</p>
<h2><strong><b>Heat stress </b></strong></h2>
<p>Global warming has brought environmental temperature stress problems on animal production around the word . Birds expose to heat stress can result on poor performance in broilers, as high morbidity and mortality in layers (Mcgeehin and Mirabelli, 2001) due to impairment to their endocrine system (Rozenboim et al., 2007), electrolytic unbalance (Teeter et al., 1985) and immune system suppression (Mashaly et al., 2004). These disorders can affect microbiota eubiosis and villus morphology (Burkholder et al., 2008).</p>
<p>Why are pigs so sensitive to heat stress?</p>
<p>Pigs are much more sensitive to heat than other animals during periods of hot weather due to pigs do not sweat and have relatively small lungs.Becuase of these physiological limitations and their relatively thick subcutaneous fat, pigs are prone to heat stress.Bigger pigs are more prone to heat stress and the reduction in growth performance is greater than for smaller pigs.</p>
<p>What does current research say about heat stress?</p>
<p>A recent publication by Pearce et al. (2013) examined what happened to the intestinal structure when pigs were exposed to heat stress. The research showed that exposure to 35°C for 24 hours significantly damaged the intestinal defence function and also increased plasma endotoxin levels. The authors explained that when pigs are exposed to heat stress (even for as little as two to six hours) their intestinal defence systems are significantly compromised and this provides opportunity for infection as pathogenic bacteria can invade the body more easily. Therefore, heat stress can create secondary infection if sanitary conditions are poor.</p>
<p>Prolonged exposure to heat stress increases corticosteroids secretions (Sapolsky et al.,2000) affecting enteric epithelia integrity. Corticosteroids secretion breaks down tight junction proteins promoting bacterial translocation and metabolic disorders. Once these anatomic structures of the enteric epithelia are affected and the physical barrier is more permeable. Therefore, bacteria and toxins can go from the lumen of the gastrointestinal tract to the blood stream. This phenomenon may lead to reduction on feed intake and digestion capability (Zhang et al., 2012) reducing performance efficiency (Azad et al., 2010).</p>
<h2><strong><b>How does probiotics impact controlling of heat stress?</b></strong></h2>
<p>Heat stress as any other stress stimulate corticosteroid secretion by the suprarenal gland (Shini et al., 200), then corticosteroid secretion is linked to the ratio of hetherophyls and lymphocytes, which is use as stress indicators (Gross and Siegel, 1983). The over secretion of corticosteroid induce the break down of tight junctions proteins leading to, not only, bacteria translocation, but also digestion and absorption disorders. Probiotics can potentially reduce the impact of extreme environmental temperature, improve feed efficiency and enhance growth rate (Eckert et al., 2010) through the down-regulation of corticosteroid secretion, resulting in an enhanced intestinal barrier and positively influenced immune response (Ng et al., 2009).</p>
<h2><strong><b>Antibiotics reduction and antibiotic-free feeding </b></strong></h2>
<p>Antibiotic-free feeding (ABF) programs is not only an antibiotics reduction or replacement strategy, but a comprehensive program that includes strengthening of biosecurity measures and progressive inclusion of feed additives alongside pharmaceutical components, such as such as vaccines, enzymes, acidifiers, phytogenics, probiotics and prebiotics in order to enhance immune system capacity to face challenges on the field.</p>
<p>The right probiotics are considered a useful tool to be included in antibiotic free production program (Gustafson and Bowen, 1997), this scientific development not only can enhance the immune response against vaccine antigens (Patterson and Burkholder, 2003), but also to decrease the impact of environmental conditions and infectious diseases  (Willis and Reid 2008).</p>
<p>probiotic are very useful alone or in combination with other antibiotic-alternatives for the control of infection due to Gram+ and – bacteria . The use of these alternatives result not only in the control of pathogenic outbreaks but with the right approach serve as natural growth promoters and used as alternative to antibiotics as growth promoters, as well as to decrease the use of antibiotics for treatments (Willis and Reid 2008). A very important clue to determine if either probiotic could be part of this kind of programs is a correct diagnostic and to determine if the probiotic mode of action may contribute to diminish the impact of the most common factors modifying animal performance.</p>
<h4><strong><b>How to choose the right </b></strong><strong><b>poultry </b></strong><strong><b>probiotic</b></strong><strong><b>s ?</b></strong></h4>
<h4><strong><b>How to choose the right </b></strong><strong><b>pig </b></strong><strong><b>probiotic</b></strong><strong><b>s ?</b></strong></h4>
<p>There are several alternatives of probiotics in the market, all with inherent advantages and disadvantages depending on the nature of the organisms and the treatment that the final product receives.</p>
<p><strong><b>Several criteria can be used to select probiotics including: </b></strong></p>
<ul>
<li>Product composition / choice of strains*</li>
<li>Documented mode of action*</li>
<li><b></b><strong><b>Stability vs efficacy</b></strong></li>
<li><b></b><strong><b>Defined vs undefined cultures</b></strong></li>
<li><b></b><strong><b>Sporulated vs non-</b></strong><strong><b>sporulated</b></strong></li>
</ul>
<p>* Regarding the first two criteria, buyers should be aware of what they’re buying and to what extent scientific studies document the effects is.</p>
<h2><strong><b>Stability vs. Efficacy</b></strong></h2>
<p><strong><b>Stability</b></strong></p>
<p>Customers often have to choose between these two criteria. However, from customer&#8217;s point of view it may be safer to select efficacy over stability for a simple reason: it is easy to check for stability and it can be demanded to the probiotic manufacturer. If the manufacturer claims a certain amount of viable colony-forming units (CFU) after pelleting or after 6 months of storage the producer is only a few samples away from the truth.</p>
<p><strong><b>Efficacy</b></strong></p>
<p>On the other hand, there is no insurance for efficacy. There are too many factors that can compromise efficacy of a product in the field: diseases, nutrition, immune status of the flock, and stress factors in general; as a consequence it is difficult for the poultry producer to evaluate the real efficacy of a given product under field conditions.</p>
<h2><strong><b>Sporulated vs. Non-Sporulated Probiotics</b></strong></h2>
<p><strong><b>Sporulated</b></strong></p>
<p>Sporulation confers an excellent method to protect bacteria against physical damage. From this starting point several advantages can be surmised. For instance, the issues of <strong><b>shelf life</b></strong> and <strong><b>storing conditions</b></strong> seem irrelevant when considering that spores can remain viable for hundreds of years. One main advantage of spores is that they can be easily incorporated into feed tolerating pelleting process with minimal reductions in viability.</p>
<p>Similarly, passage through the stomach should not be a problem for a spore. However, all those advantages seem to pale if the natural habitat of the most currently used sporulated bacteria is considered: Bacillus sp. are well recognized as environmental bacteria. This apparently simple statement draws a question mark on most scientific evidence supporting the effect of the vegetative form of these bacteria against pathogens.</p>
<p>By definition, a dormant life form does not utilize a lot of environmental resources and thus not very many biochemical reactions are taking place.</p>
<p>Competition for available nutrients, production of antibacterial substances, direct inhibition of pathogens, and probably even active attachment and competition for binding sites are all doubtful in case spores are not able to transform into vegetative cells inside the intestinal tract. Valid scientific evidence should address possible mechanisms of action in vivo.</p>
<p><strong><b>Non-sporulated</b></strong></p>
<p>In contrast to spores, when considering long storing periods, pelleting, and passage through the stomach, the non-sporulated bacteria seem fragile. Some of these weaknesses can be partially solved by a coating treatment if the bacteria are to be mixed in feed that will be pelleted.</p>
<p><strong><b>Quality of the coating</b></strong> will determine the cell viability after pelleting and after passage through the stomach. Despite all these weaknesses, when vegetative probiotics (of intestinal origin) reach the intestine they are &#8220;at home&#8221;. If the probiotic strains originate from a compatible animal —or even better from the same animal species— there will be no better place for these bacteria to grow, replicate, compete for nutrients, attach to cellular receptors, and to interact with the host than in the intestine.</p>
<p>From this point of view there is a huge potential for future development of probiotics. It is very likely that in the in vitro process of screening we have lost excellent candidates due to our current inability to create a model that closely resembles the intestinal tract. It is becoming increasingly clear that interaction between bacteria and their environment is very important when analyzing the efficacy of probiotics.</p>
]]></content:encoded>
					
		
		
			</item>
		<item>
		<title>From broiler breeder hen feed to the egg and embryo: The molecular effects of guanidinoacetate supplementation on creatine transport and synthesis</title>
		<link>https://www.phiphar.com/from-broiler-breeder-hen-feed-to-the-egg-and-embryo-the-molecular-effects-of-guanidinoacetate-supplementation-on-creatine-transport-and-synthesis/</link>
		
		<dc:creator><![CDATA[phiphar]]></dc:creator>
		<pubDate>Fri, 17 Jul 2020 02:42:09 +0000</pubDate>
				<category><![CDATA[Uncategorized]]></category>
		<guid isPermaLink="false">https://www.phiphar.com/?p=905</guid>

					<description><![CDATA[Abstract Supplementation of broiler breeder hens with beneficial additives bears great potential for affecting nutrient deposition into the fertile egg. Guanidinoacetate (GAA) is the endogenous precursor of creatine that is used as a feed additive for improving cellular energy metabolism in animal nutrition. In the present study, we have investigated whether GAA supplementation in [...]]]></description>
										<content:encoded><![CDATA[<div class="fusion-fullwidth fullwidth-box fusion-builder-row-1 nonhundred-percent-fullwidth non-hundred-percent-height-scrolling"  style='background-color: rgba(255,255,255,0);background-position: center center;background-repeat: no-repeat;padding-top:0px;padding-right:0px;padding-bottom:0px;padding-left:0px;'><div class="fusion-builder-row fusion-row "><div  class="fusion-layout-column fusion_builder_column fusion_builder_column_1_1 fusion-builder-column-0 fusion-one-full fusion-column-first fusion-column-last 1_1"  style='margin-top:0px;margin-bottom:20px;'><div class="fusion-column-wrapper" style="padding: 0px 0px 0px 0px;background-position:left top;background-repeat:no-repeat;-webkit-background-size:cover;-moz-background-size:cover;-o-background-size:cover;background-size:cover;"   data-bg-url=""><div class="fusion-text"><div id="abstracts" class="Abstracts u-font-serif">
<div id="abs0010" class="abstract author" lang="en">
<h2 class="section-title u-h3 u-margin-l-top u-margin-xs-bottom">Abstract</h2>
<div id="abssec0010">
<p id="abspara0010">Supplementation of broiler breeder hens with beneficial additives bears great potential for affecting nutrient deposition into the fertile egg. Guanidinoacetate (<strong>GAA</strong>) is the endogenous precursor of creatine that is used as a feed additive for improving cellular energy metabolism in animal nutrition. In the present study, we have investigated whether GAA supplementation in broiler breeder feed affects creatine deposition into the hatching egg and molecular mechanisms of creatine transport and synthesis within hens and their progeny. For this, broiler breeder hens of 47 wk of age were supplemented with 0.15% GAA for 15 wk, and samples from their tissues, hatching eggs and progeny were compared with those of control, nonsupplemented hens. A significant increase in creatine content was found within the yolk and albumen of hatching eggs obtained from the GAA group, compared with the control group. The GAA group exhibited a significant increased creatine transporter gene expression compared with the control group in their small intestines and oviduct. In GAA group progeny, a significant decrease in creatine transporter expression at embryonic day 19 and day of hatch was found, compared with control group progeny. At the day of hatch, creatine synthesis genes (arginine glycine amidinotransferase and guanidinoacetate N-methyltransferase) exhibited significant decrease in expression in the GAA group progeny compared with control group progeny. These results indicate that GAA supplementation in broiler breeder feed increases its absorbance and deposition into hatching eggs, subsequently affecting GAA and creatine absorbance and synthesis within broiler progeny.</p>
</div>
</div>
</div>
<section id="sec1">
<h2 id="sectitle0020" class="u-h3 u-margin-l-top u-margin-xs-bottom">Introduction</h2>
<p id="p0010">The avian embryo relies solely on the egg components (yolk and albumen) for all its nutritional requirements. During egg formation, nutrients are deposited into the egg compartments in quantities and ratios that are determined by the maternal hen&#8217;s nutritional status (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib22" name="bbib22">Romanoff, 1960</a>). Yolk nutrients are transported from the bloodstream into the developing oocyte to form the egg yolk (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib21" name="bbib21">Perry et al., 1978</a>). In the egg, yolk nutrients and macromolecules are absorbed, metabolized, and transported into the embryonic bloodstream via the yolk sac tissue (<strong>YST</strong>) (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib18" name="bbib18">Noble and Cocchi, 1990</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib29" name="bbib29">Yadgary et al., 2013</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib23" name="bbib23">Schneider, 2016</a>). Albumen components accumulate from the hen&#8217;s bloodstream by the magnum segment of the oviduct (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib6" name="bbib6">Edwards et al., 1974</a>). In the egg, most albumen nutrients are consumed orally by the embryo along with the amniotic fluid, while residuals enter the yolk sac before hatch through the yolk stalk (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib22" name="bbib22">Romanoff, 1960</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib16" name="bbib16">Moran, 2007</a>). Broiler breeder nutrition is therefore highly important for the developing embryo&#8217;s nutritional and energetic status. This topic has been studied as means for affecting broiler offspring performance, such as BW and feed intake (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib1" name="bbib1">Aitken et al., 1969</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib26" name="bbib26">van Emous et al., 2015</a>). It is hypothesized that nowadays, the hatching egg components do not fully meet the physiological requirements of fast-growing broiler embryos owing to nutritional limitations. Therefore, numerous studies have investigated the effects of specific nutrients and feed additives in broiler breeder feed on broiler progeny (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib27" name="bbib27">Wilson, 1997</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib30" name="bbib30">Yair and Uni, 2011</a>).</p>
<p id="p0015">A highly favorable feed supplement for overcoming energetic limitations in humans is guanidinoacetate (GAA). Guanidinoacetate is an endogenously synthesized precursor of the creatine biomolecule, which plays a key role in cellular energy metabolism (Reviewed by <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib19" name="bbib19">Ostojic, 2015</a>). The biosynthesis of GAA initiates in the kidneys, where glycine and arginine create a bond catalyzed by arginine glycine amidinotransferase (<strong>AGAT</strong>), producing GAA. Guanidinoacetate is then transferred from the kidneys to the liver, where it is methylated by guanidinoacetate N-methyltransferase (<strong>GAMT</strong>), to form creatine. Through the bloodstream, creatine reaches cells with high energetic requirements such as central nervous system neurons, myocytes, and spermatozoa. Intracellularly, creatine is phosphorylated into phosphocreatine, which converts ADP into ATP during its dephosphorylation. Therefore, cellular creatine functions as an energy storage molecule, which can generate ATP on demand (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib28" name="bbib28">Wyss and Kaddurah-Daouk, 2000</a>). Guanidinoacetate is therefore a favorable feed additive, owing to its role in maintaining available cellular energy and its chemical stability (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib19" name="bbib19">Ostojic, 2015</a>). In poultry, several studies on broilers have shown beneficial effects of GAA supplementation on muscle creatine concentrations, feed efficiency, and meat yield, with potential for sparing dietary arginine (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib15" name="bbib15">Michiels et al., 2012</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib4" name="bbib4">Degroot et al., 2018</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib5" name="bbib5">Degroot et al., 2019</a>). Guanidinoacetate supplementation in broiler breeder hen feed may therefore benefit broiler progeny during development and alleviate their energetic limitations. For investigating this topic, information regarding the transfer of GAA and creatine from the hen to embryo through the egg components is needed. Generally, GAA and creatine enter animal cells through a specific symporter called the creatine transporter (<strong>CRT</strong>) (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib8" name="bbib8">Guerrero-Ontiveros and Wallimann, 1998</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib17" name="bbib17">Murphy et al., 2001</a>). Creatine transporter mRNA and protein were found to be highly expressed in the epithelial cell lining of small intestinal villi of humans, rats, and chickens (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib20" name="bbib20">Peral et al., 2002</a>). Several studies in various animal models demonstrated that CRT mRNA expression is affected by creatine and GAA supplementation (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib8" name="bbib8">Guerrero-Ontiveros and Wallimann, 1998</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib7" name="bbib7">Ellery et al., 2016</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib10" name="bbib10">Li et al., 2018</a>).</p>
<p id="p0020">In the present study, we found that GAA supplementation in broiler breeder feed affects creatine deposition into the hatching egg and molecular mechanisms of creatine transport and synthesis within hens and their progeny. The experiment was conducted by supplementing broiler breeder hens with 0.15% Creamino (GAA-based feed additive) for 15 wk, analyzing their hatching eggs for creatine contents, sampling tissues involved in creatine absorption (digestive tracts) and deposition into the hatching egg (ovary and oviducts), as well as tissues of their progeny for gene expression analyses of genes involved in creatine transport and synthesis.</p>
</section>
<section id="sec2">
<h2 id="sectitle0025" class="u-h3 u-margin-l-top u-margin-xs-bottom">Experimental methods</h2>
<section id="sec2.1">
<h3 id="sectitle0030" class="u-h4 u-margin-m-top u-margin-xs-bottom">Broiler Breeder Feeding, Housing, and GAA Supplementation</h3>
<div>
<p id="p0025">All procedures followed established guidelines for animal care and handling and were approved by the Institutional Animal Care and Use Committee of Hebrew University (AG-15-14666-2s). A 47-week-old Cobb500 broiler breeder flock was purchased from a commercial breeder farm (Alonim, Israel) and raised in individual pens in the Hebrew University, Faculty of Agriculture. Hens were artificially inseminated every 5 D with fresh semen from male counterparts. Twleve hens were randomly selected and divided into 2 equal-weight groups, with an average BW of 4,535 g and <strong>SD</strong> of 365.4 g. Both groups were fed with standard, mashed feed (Ambar Feed Mill, Israel) as indicated in <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1" name="btbl1">Table 1</a>. Guanidinoacetate group feed was supplemented with 0.15% GAA:1.5 kg/ton Creamino (min 96% GAA) on top of feed, as per the manufacturer’s recommendations (AlzChem GmbH, Trostberg, Germany). Dietary CP and amino acid analysis of the experimental feeds was conducted by Evonik (Hanau, Germany), and GAA analysis was conducted by AlzChem GmbH (Trostberg, Germany). Hens were fed daily with 145 g of feed, and water was provided ad libitum, in accordance with the Cobb breeder management guide, with adjustments in respect to the flock average BW.</p>
</div>
<div id="tbl1" class="tables frame-topbot colsep-0 rowsep-0">
<p id="tspara0010"><span class="label">Table 1</span>. Ingredient and nutrient composition of the control and 0.15% GAA feed.</p>
<div class="groups">
<table>
<thead>
<tr class="rowsep-1 valign-top">
<th scope="col">Raw material (%)</th>
<th scope="col">Control feed</th>
<th scope="col">GAA-suppl. Feed</th>
</tr>
</thead>
<tbody>
<tr class="valign-top">
<td>Wheat</td>
<td class="align-char">22</td>
<td class="align-char">22</td>
</tr>
<tr class="valign-top">
<td>Corn</td>
<td class="align-char">43</td>
<td class="align-char">43</td>
</tr>
<tr class="valign-top">
<td>Soybean meal</td>
<td class="align-char">14</td>
<td class="align-char">14</td>
</tr>
<tr class="valign-top">
<td>Sunflower meal</td>
<td class="align-char">8</td>
<td class="align-char">8</td>
</tr>
<tr class="valign-top">
<td>Wheat bran</td>
<td class="align-char">1</td>
<td class="align-char">1</td>
</tr>
<tr class="valign-top">
<td>Soapstock oil</td>
<td class="align-char">2.5</td>
<td class="align-char">2.5</td>
</tr>
<tr class="valign-top">
<td>Calcium carbonate</td>
<td class="align-char">7.7</td>
<td class="align-char">7.7</td>
</tr>
<tr class="valign-top">
<td>MCP<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn1" name="btbl1fn1"><sup>1</sup></a></td>
<td class="align-char">0.49</td>
<td class="align-char">0.49</td>
</tr>
<tr class="valign-top">
<td>NaCl</td>
<td class="align-char">0.25</td>
<td class="align-char">0.25</td>
</tr>
<tr class="valign-top">
<td>Moldstop</td>
<td class="align-char">0.1</td>
<td class="align-char">0.1</td>
</tr>
<tr class="valign-top">
<td>Sodium bicarbonate</td>
<td class="align-char">0.14</td>
<td class="align-char">0.14</td>
</tr>
<tr class="valign-top">
<td>Vitamin and mineral mix<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn2" name="btbl1fn2"><sup>2</sup></a></td>
<td class="align-char">1.2</td>
<td class="align-char">1.2</td>
</tr>
<tr class="valign-top">
<td><strong>Nutrient</strong></td>
<td><strong>%</strong></td>
<td><strong>%</strong></td>
</tr>
<tr class="valign-top">
<td> <em>Calculated/(analyzed)</em><a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a><br />
CP</td>
<td>15.0 (16.05)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>15.0 (16.29)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> Crude fat</td>
<td class="align-char">4.0</td>
<td class="align-char">4.0</td>
</tr>
<tr class="valign-top">
<td> Fiber</td>
<td class="align-char">4.5</td>
<td class="align-char">4.5</td>
</tr>
<tr class="valign-top">
<td> Ash</td>
<td class="align-char">10.5</td>
<td class="align-char">10.5</td>
</tr>
<tr class="valign-top">
<td> Calcium</td>
<td class="align-char">3.2</td>
<td class="align-char">3.2</td>
</tr>
<tr class="valign-top">
<td> Total phosphorus</td>
<td class="align-char">0.45</td>
<td class="align-char">0.45</td>
</tr>
<tr class="valign-top">
<td> Methionine</td>
<td>0.38 (0.47)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>0.38 (0.43)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> Met + Cys</td>
<td>0.65 (0.75)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>0.65 (0.71)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> Lysine</td>
<td>0.67 (0.94)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>0.67 (0.75)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> Arginine</td>
<td>0.95 (0.99)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>0.95 (0.98)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> Threonine</td>
<td>0.55 (0.65)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>0.55 (0.64)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> Linoleic acid</td>
<td class="align-char">1.55</td>
<td class="align-char">1.55</td>
</tr>
<tr class="valign-top">
<td> Sodium</td>
<td class="align-char">0.16</td>
<td class="align-char">0.16</td>
</tr>
<tr class="valign-top">
<td> Potassium</td>
<td class="align-char">0.67</td>
<td class="align-char">0.67</td>
</tr>
<tr class="valign-top">
<td> Chlorine</td>
<td class="align-char">0.21</td>
<td class="align-char">0.21</td>
</tr>
<tr class="valign-top">
<td> GAA<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn3" name="btbl1fn3"><sup>3</sup></a>, mg/kg</td>
<td>(235)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
<td>(1701)<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl1fn4" name="btbl1fn4"><sup>4</sup></a></td>
</tr>
<tr class="valign-top">
<td> ME (Kcal/kg)</td>
<td class="align-char">2,800</td>
<td class="align-char">2,800</td>
</tr>
</tbody>
</table>
</div>
<dl class="footnotes">
<dt id="tbl1fn1">1</dt>
<dd>
<p id="ntpara0010">Abbreviations: GAA, guanidinoacetate; MCP, monocalcium phosphate.</p>
</dd>
<dt id="tbl1fn2">2</dt>
<dd>
<p id="ntpara0015">According to Cobb nutritional recommendation tables for broiler breeders 2015.</p>
</dd>
<dt id="tbl1fn3">3</dt>
<dd>
<p id="ntpara0020">GAA was added on top of the feed, and no arginine and energy matrix values were used in the present study.</p>
</dd>
<dt id="tbl1fn4">4</dt>
<dd>
<p id="ntpara0025">Standardized to DM content of 88%.</p>
</dd>
</dl>
</div>
</section>
</section>
<h3 id="sectitle0035" class="u-h4 u-margin-m-top u-margin-xs-bottom">Sampling GAA Concentraion in Hatching Eggs</h3>
<p id="p0030">After 11 wk of supplementation, at 58 wk of age, eggs were collected from all 6 hens of each group. Whole eggs were weighed; their yolks and the albumens were separated and collected in 2 sets of tubes. One set was stored in -20°C, and the second set was freeze-dried by a Labconco Freeze Dryer (Kansas City, MO). Frozen samples were termed “fresh,” and freeze-dried samples were termed “dry.” All samples were weighed before further analyses. Dry samples were sent to AlzChem GmbH (Trostberg, Germany) for measuring of GAA and creatine concentrations. Total creatine content in dry samples (yolks and albumens) was calculated as follows:<span id="ufd1" class="formula"><span id="MathJax-Element-1-Frame" class="MathJax_SVG" tabindex="0" role="presentation" data-mathml="&lt;math xmlns=&quot;http://www.w3.org/1998/Math/MathML&quot;&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;total&amp;#xA0;creatine&amp;#xA0;content&amp;#xA0;in&amp;#xA0;dry&amp;#xA0;sample&amp;#xA0;&lt;/mtext&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;(&lt;/mo&gt;&lt;mtext is=&quot;true&quot;&gt;mg&lt;/mtext&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;)&lt;/mo&gt;&lt;/mrow&gt;&lt;mo linebreak=&quot;badbreak&quot; is=&quot;true&quot;&gt;=&lt;/mo&gt;&lt;mfrac is=&quot;true&quot;&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;creatine&amp;#xA0;concentration&amp;#xA0;in&amp;#xA0;dry&amp;#xA0;sample&lt;/mtext&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;(&lt;/mo&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mfrac is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;mg&lt;/mtext&gt;&lt;mtext is=&quot;true&quot;&gt;g&lt;/mtext&gt;&lt;/mfrac&gt;&lt;/mrow&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;)&lt;/mo&gt;&lt;/mrow&gt;&lt;/mrow&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;dry&amp;#xA0;sample&amp;#xA0;weight&amp;#xA0;&lt;/mtext&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;(&lt;/mo&gt;&lt;mtext is=&quot;true&quot;&gt;g&lt;/mtext&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;)&lt;/mo&gt;&lt;/mrow&gt;&lt;/mrow&gt;&lt;/mfrac&gt;&lt;/mrow&gt;&lt;/math&gt;"></span></span></p>
<p id="p0035">Creatine concentrations in fresh samples (yolks and albuments) were calculated as follows:<span id="ufd2" class="formula"><span id="MathJax-Element-2-Frame" class="MathJax_SVG" tabindex="0" role="presentation" data-mathml="&lt;math xmlns=&quot;http://www.w3.org/1998/Math/MathML&quot;&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;creatine&amp;#xA0;concentration&amp;#xA0;in&amp;#xA0;fresh&amp;#xA0;sample&amp;#xA0;&lt;/mtext&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;(&lt;/mo&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mi is=&quot;true&quot;&gt;m&lt;/mi&gt;&lt;mi is=&quot;true&quot;&gt;g&lt;/mi&gt;&lt;/mrow&gt;&lt;mo linebreak=&quot;badbreak&quot; is=&quot;true&quot;&gt;/&lt;/mo&gt;&lt;mi is=&quot;true&quot;&gt;g&lt;/mi&gt;&lt;/mrow&gt;&lt;/mrow&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;)&lt;/mo&gt;&lt;/mrow&gt;&lt;mo linebreak=&quot;badbreak&quot; is=&quot;true&quot;&gt;=&lt;/mo&gt;&lt;mfrac is=&quot;true&quot;&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;creatine&amp;#xA0;content&amp;#xA0;in&amp;#xA0;dry&amp;#xA0;sample&lt;/mtext&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;(&lt;/mo&gt;&lt;mtext is=&quot;true&quot;&gt;mg&lt;/mtext&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;)&lt;/mo&gt;&lt;/mrow&gt;&lt;/mrow&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mtext is=&quot;true&quot;&gt;fresh&amp;#xA0;sample&amp;#xA0;weight&amp;#xA0;&lt;/mtext&gt;&lt;mrow is=&quot;true&quot;&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;(&lt;/mo&gt;&lt;mtext is=&quot;true&quot;&gt;g&lt;/mtext&gt;&lt;mo stretchy=&quot;true&quot; is=&quot;true&quot;&gt;)&lt;/mo&gt;&lt;/mrow&gt;&lt;/mrow&gt;&lt;/mfrac&gt;&lt;/mrow&gt;&lt;/math&gt;"></span></span></p>
<section id="sec2">
<section id="sec2.2">
<p id="p0040">Total egg creatine content was calculated by summation of total creatine content in dry yolk and dry albumen.</p>
</section>
<section id="sec2.3">
<h3 id="sectitle0040" class="u-h4 u-margin-m-top u-margin-xs-bottom">Tissue Sampling and RNA Extraction</h3>
<p id="p0045">After a 15-wk period of GAA supplementation, hen and progeny tissues from the 0.15% GAA and control groups were collected for mRNA relative expression analyses as follows: 6 fertile eggs from each group (one per hen) were collected from each group and incubated in a Petersime hatchery (Zulte, Belgium) under standard conditions (37.5°C, 60% RH). Subsequently, 6 hens from each group were sacrificed by cervical dislocation. The following tissues were immediately collected and stored in RNA save (Biological Industries, Beit Haemek, Israel): the duodenum, jejunum and ileum segments of the small intestine and the ovary, magnum and isthmus of the reproductive tract. At the final stage of egg incubation, progeny (embryos and hatchlings) were killed by cervical dislocation at embryonic ages E17, E19, and day of hatch (<strong>DOH</strong>). Their YST, small intestines, kidneys, and livers were removed and stored in RNA save (Biological Industries, Beit Haemek, Israel). Total RNA was isolated from all tissue samples using Tri-Reagent (Bio-Lab, Jerusalem, Israel) as per the manufacturer&#8217;s protocol. cDNA was synthesized from 1.0 μg total RNA using the RevertAid RT-PCR Kit (Thermo Fisher Scientific, Tamar, Mevaseret-Zion, Israel) in a T100 Bio-Rad instrument (Hercules, CA, USA), as per the manufacturer&#8217;s protocol.</p>
</section>
<section id="sec2.4">
<h3 id="sectitle0045" class="u-h4 u-margin-m-top u-margin-xs-bottom">Primer Design, RT-PCR, and Transcript Validation</h3>
<div>
<p id="p0050"><em>Gallus gallus</em> CRT, AGAT, and GAMT primers were designed with NCBI Primer-BLAST (<a href="https://www.ncbi.nlm.nih.gov/tools/primer-blast/" target="_blank" rel="noreferrer noopener">https://www.ncbi.nlm.nih.gov/tools/primer-blast/</a>), specifically for the domestic chicken species (<em>G. gallus</em>). Primer sequences and references are detailed in <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl2" name="btbl2">Table 2</a> cDNA samples were amplified in a PCR using the T100 Bio-Rad instrument (Hercules, CA, USA), using the following primers: CRT, AGAT, GAMT, and β-actin as a reference gene. Single bands for each gene tested were confirmed by 1.5% agarose gel electrophoresis and visualized using ChemiDoc XRS+Bio-Rad instrument (Hercules, CA, USA) for validating their sizes in bp. Creatine transporter, AGAT, and GAMT PCR product fragments were extracted with a Geneaid kit (Talron Biotech Ltd., Rehovot, Israel) and sequenced (Weizmann Institute of Science). The sequence of these fragments were validated by comparison with a broiler&#8217;s intestinal CRT sequence published in the NCBI database (<a href="https://www.ncbi.nlm.nih.gov/nuccore/" target="_blank" rel="noreferrer noopener">https://www.ncbi.nlm.nih.gov/nuccore/</a>).</p>
<div id="tbl2" class="tables frame-topbot colsep-0 rowsep-0">
<p id="tspara0015"><span class="label">Table 2</span>. Primers used for PCR and real-time PCR analysis of relative gene expression.</p>
<div class="groups">
<table>
<thead>
<tr class="rowsep-1 valign-top">
<th scope="col">Gene<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl2fn1" name="btbl2fn1"><sup>1</sup></a> type</th>
<th scope="col">Name</th>
<th scope="col">Accession number</th>
<th scope="col">Forward primer (5′)</th>
<th scope="col">Reverse primer (3′)</th>
<th scope="col">Product Length</th>
</tr>
</thead>
<tbody>
<tr class="valign-top">
<td>Target</td>
<td>CRT</td>
<td><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=JN628439.2" target="_blank" rel="noreferrer noopener">JN628439.2</a></td>
<td>CTCTTCAAAGGTCTGGGCTTGG</td>
<td>CAGAACTCGATGACGGGTGA</td>
<td class="align-char">281</td>
</tr>
<tr class="valign-top">
<td>Target</td>
<td>AGAT</td>
<td>NM204745.1</td>
<td>ACATCTTGCACCTGACTACCG</td>
<td>ACAGTGGGTGATCATCAGGAA</td>
<td class="align-char">206</td>
</tr>
<tr class="valign-top">
<td>Target</td>
<td>GAMT</td>
<td>XM015299974.2</td>
<td>ACACAAGGTGGTGCCACTGA</td>
<td>CGAGGTGAGGTTGCAGTAGG</td>
<td class="align-char">199</td>
</tr>
<tr class="valign-top">
<td>Reference</td>
<td>β-actin</td>
<td>NM205518.1</td>
<td>AATGGCTCCGGTATGTGCAA</td>
<td>GGCCCATACCAACCATCACA</td>
<td class="align-char">112</td>
</tr>
<tr class="valign-top">
<td>Reference</td>
<td>CycA</td>
<td><a href="http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=search&amp;db=nucleotide&amp;doptcmdl=genbank&amp;term=GQ849480.1" target="_blank" rel="noreferrer noopener">GQ849480.1</a></td>
<td>GGCTACAAGGGCTCCTGCTT</td>
<td>CCGTTGTGGCGCGTAAA</td>
<td class="align-char">77</td>
</tr>
<tr class="valign-top">
<td>Reference</td>
<td>RPLP0</td>
<td>NM204987</td>
<td>ACACTGGTCTCGGACCTGAGAA</td>
<td>AGCTGCACATCACTCAGAATTTCA</td>
<td class="align-char">100</td>
</tr>
</tbody>
</table>
</div>
<dl class="footnotes">
<dt id="tbl2fn1">1</dt>
<dd>
<p id="ntpara0030">Abbreviations: AGAT, arginine glycine amidinotransferase; CycA, cycline A; CRT, creatine transporter; GAMT, guanidinoacetate N-methyltransferase; RPLP0, 60S acidic ribosomal protein P0.</p>
</dd>
</dl>
</div>
</div>
</section>
<section id="sec2.5">
<h3 id="sectitle0050" class="u-h4 u-margin-m-top u-margin-xs-bottom">Real-Time PCR for Relative mRNA Expression</h3>
<p id="p0055">Real-time PCR was performed using a Roche LightCycler 96 instrument. The PCR reaction (20 μL total) was composed of 3.0 μL of cDNA sample diluted 1:25 (each sample from hen and progeny intestinal segments) or 1:5 (each sample from hen ovary and oviduct segments), 1 μL of each primer (4 μM), 5 μL ultra pure water (Biological Industries, Beit Haemek, Israel), and 10 μL of Platinum SYBR Green qPCR SuperMix-UDG (Thermo Fisher Scientific, Modi&#8217;in, Israel). All PCR reactions were performed in duplicates in ABgene PCR plates (Thermo Fisher Scientific, Modi&#8217;in, Israel) closed with optically clear flat qPCR caps (Thermo Fisher Scientific, Modi&#8217;in, Israel) under the following conditions: 50 °C for 2 min, 95 °C for 2 min, and 40 cycles of 95 °C for 30 seconds and 60 °C for 1 min. To ensure amplification of a single product, a dissociation curve was determined under the following conditions: 95 °C for 1 min, 55 °C for 30 s, and 95 °C for 30 s. A standard curve was generated for each target and reference gene, assuring R<sup>2</sup> values of &gt;0.9 gene efficiencies of 2 ± 0.1. To avoid false positives, a nontemplate control was run for each template and primer pair. Cycle threshold values for each sample were calculated using the Roche LightCycler 96 program, and gene expression was normalized against the reference gene(s) in every experiment, assuring consistent reference gene cycle threshold values for all samples, as follows: geometric average of β-actin and CycA for hen intestinal segments; geometric average of CycA and RPLP0 for ovary and oviduct segments; RPLP0 for progeny tissues. All expression levels are shown as fold change in arbitrary units calculated using the 2<sup>−ΔΔCt</sup> method as described by <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib12" name="bbib12">Livak and Schmittgen (2001)</a>.</p>
</section>
<section id="sec2.6">
<h3 id="sectitle0055" class="u-h4 u-margin-m-top u-margin-xs-bottom">Statistical Analyses</h3>
<p id="p0060">Treatment-dependent effects were analyzed by ANOVA. All analyses were validated for normal distribution and equal variances between treatments. <em>T</em> tests for 2-tailed comparisons were performed following ANOVA and presented with an asterix as an indicator for significant differences (at <em>P</em> &lt; 0.05). JMP, version 14.0 (SAS Institute, Cary, NC), was used for all analyses. Values are presented as means ± SEM.</p>
</section>
</section>
<section id="sec3">
<h2 id="sectitle0060" class="u-h3 u-margin-l-top u-margin-xs-bottom">Results</h2>
<section id="sec3.1">
<h3 id="sectitle0065" class="u-h4 u-margin-m-top u-margin-xs-bottom">Guanidinoacetate Concentration in Broiler Breeder Feed</h3>
<p id="p0065">Analyses of GAA in the feed indicated a content of 235 mg/kg in the control group and 1,701 mg/kg in the 0.15% GAA group.</p>
</section>
<section id="sec3.2">
<h3 id="sectitle0070" class="u-h4 u-margin-m-top u-margin-xs-bottom">Egg Creatine Concentrations</h3>
<div>
<p id="p0070">As indicated in <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl3" name="btbl3">Table 3</a>, significant increases in creatine concentrations were found in freeze-dried samples of the yolk and albumen of eggs obtained from the GAA group, compared with those in the control group. Accordingly, total creatine contents in yolks, albumens, and whole eggs were significantly increased as a result of 0.15% GAA supplementation. This effect was stronger in egg yolks than in egg albumens: 52% increase in total yolk creatine content (<em>P</em> &lt; 0.0001) and 21% increase in total albumen creatine (<em>P</em> = 0.03). Total egg creatine content was increased by 42% (<em>P</em> &lt; 0.0001) in the GAA group, compared with that in the control group.</p>
<div id="tbl3" class="tables frame-topbot colsep-0 rowsep-0">
<p id="tspara0020"><span class="label">Table 3</span>. Creatine concentration and total content in egg compartments in control and 0.15% GAA groups.</p>
<div class="groups">
<table>
<thead>
<tr class="rowsep-1 valign-top">
<th scope="col">Variable</th>
<th scope="col">Control (0.00% GAA)</th>
<th scope="col">Treatment (0.15% GAA)</th>
<th scope="col"><em>P</em>-value</th>
</tr>
</thead>
<tbody>
<tr class="valign-top">
<td>Creatine concentration in dry albumen (mg/kg)</td>
<td class="align-char">15.154 ± 0.081</td>
<td class="align-char">19.1 ± 1.069</td>
<td class="align-char">0.007</td>
</tr>
<tr class="valign-top">
<td>Total creatine in the albumen (mg)</td>
<td class="align-char">0.076 ± 0.004</td>
<td class="align-char">0.092 ± 0.005</td>
<td class="align-char">0.034</td>
</tr>
<tr class="valign-top">
<td>Creatine concentration in dry yolk (mg/kg)</td>
<td class="align-char">16.615 ± 0.549</td>
<td class="align-char">26.8 ± 0.952</td>
<td class="align-char">&lt;0.0001</td>
</tr>
<tr class="valign-top">
<td>Total creatine in the yolk (mg)</td>
<td class="align-char">0.167 ± 0.006</td>
<td class="align-char">0.254 ± 0.007</td>
<td class="align-char">&lt;0.0001</td>
</tr>
<tr class="valign-top">
<td>Total egg creatine</td>
<td class="align-char">0.243 ± 0.01</td>
<td class="align-char">0.346 ± 0.012</td>
<td class="align-char">&lt;0.0001</td>
</tr>
</tbody>
</table>
</div>
<p id="tspara0025">Values are means ± SEM; “dry” = freeze-dried albumen/yolk; n = 13.</p>
<p id="tspara0030">Abbreviation: GAA, guanidinoacetate.</p>
</div>
</div>
</section>
<section id="sec3.3">
<h3 id="sectitle0075" class="u-h4 u-margin-m-top u-margin-xs-bottom">Creatine Transporter Gene Expression in Hen and Progeny Tissues</h3>
<div>
<p id="p0075">The CRT gene was found to be expressed in the broiler breeder hens’ small intestines, ovaries, and oviducts (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig1" name="bfig1">Figure 1</a>A). Furthermore, CRT expression was evident in in late embryonic and hatchling YST and small intestines (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig1" name="bfig1">Figure 1</a>B).</p>
<figure id="fig1" class="figure text-xs"><img decoding="async" src="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr1.jpg" alt="" height="469" aria-describedby="cap0010" /></p>
<ol class="links-for-figure">
<li><a class="anchor download-link u-font-sans" title="Download full-size image" href="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr1.jpg" target="_blank" rel="noopener noreferrer" download=""><span class="anchor-text">Download : <span class="download-link-title">Download full-size image</span></span></a></li>
</ol>
<p id="fspara0010"><span class="label">Figure 1</span>. Creatine transporter expression in hen and progeny tissues by gel electrophoresis. Templates were cDNA prepared from RNA isolated from (A) the hen’s small intestinal segments and reproductive tract and (B) progeny yolk sac tissues and small intestines. cDNA-amplified products of the expected sizes were obtained for CRT (281 bp) and β-actin (112 bp). Abbreviation: CRT, creatine transporter.</p>
</figure>
</div>
</section>
<section id="sec3.4">
<h3 id="sectitle0080" class="u-h4 u-margin-m-top u-margin-xs-bottom">The Effect of GAA Supplementation on Hen CRT Relative Expression</h3>
<div>
<p id="p0080">In the duodenum, CRT relative expression increased 2-fold in the GAA group, compared with that in the control group (<em>P</em> = 0.02). No significant differences in CRT relative expression were observed in the jejunim and ileum segments of the small intestine (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig2" name="bfig2">Figure 2</a>). In the oviduct (magnum segment), CRT relative expression increased 2.1-fold in the GAA group, compared with that in the control group (<em>P</em> = 0.03). No significant differences in CRT relative expression were observed in the ovary or isthmus segment of the oviduct (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig3" name="bfig3">Figure 3</a>).</p>
<figure id="fig2" class="figure text-xs"><img decoding="async" src="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr2.jpg" alt="" height="249" aria-describedby="cap0015" /></p>
<ol class="links-for-figure">
<li><a class="anchor download-link u-font-sans" title="Download full-size image" href="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr2.jpg" target="_blank" rel="noopener noreferrer" download=""><span class="anchor-text">Download : <span class="download-link-title">Download full-size image</span></span></a></li>
</ol>
<p id="fspara0015"><span class="label">Figure 2</span>. Creatine transporter relative expression in hen small intestinal segments after 15 wk of GAA supplementation. Values are presented as mean fold change ± SEM. Significant differences within a segment between the control and 0.15% GAA groups by <em>t</em> test are marked by an asterix (<em>P</em> &lt; 0.05). Abbreviations: CRT, creatine transporter; GAA, guanidinoacetate.</p>
</figure>
<figure id="fig3" class="figure text-xs"><img decoding="async" src="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr3.jpg" alt="" height="697" aria-describedby="cap0020" /></p>
<ol class="links-for-figure">
<li><a class="anchor download-link u-font-sans" title="Download full-size image" href="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr3.jpg" target="_blank" rel="noopener noreferrer" download=""><span class="anchor-text">Download : <span class="download-link-title">Download full-size image</span></span></a></li>
</ol>
<p id="fspara0020"><span class="label">Figure 3</span>. Creatine transporter relative expression in different segments of hen reproductive tracts after 15 wks of GAA supplementation. The segments examined were (A) ovary, (B) magnum, and (C) isthmus. Values are presented as mean fold change ± SEM. Significant differences within a segment between the control and 0.15% GAA groups by <em>t</em> test are marked by an asterix (<em>P</em> &lt; 0.05). Abbreviations: CRT, creatine transporter; GAA, guanidinoacetate.</p>
</figure>
</div>
</section>
<section id="sec3.5">
<h3 id="sectitle0085" class="u-h4 u-margin-m-top u-margin-xs-bottom">The Effect of GAA Supplementation on Progeny CRT Relative Expression</h3>
<div>
<p id="p0085">At the embryonic age E19 and at DOH, CRT relative expression in the small intestines of progeny of the GAA group was decreased 0.7-fold compared with that of progeny of the control group. At E19, CRT relative expression was decreased 0.7-fold (<em>P</em> = 0.01), and at DOH, CRT relative expression was decreased 0.76-fold (<em>P</em> = 0.04) (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig4" name="bfig4">Figure 4</a>).</p>
<figure id="fig4" class="figure text-xs"><img decoding="async" src="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr4.jpg" alt="" height="238" aria-describedby="cap0025" /></p>
<ol class="links-for-figure">
<li><a class="anchor download-link u-font-sans" title="Download full-size image" href="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr4.jpg" target="_blank" rel="noopener noreferrer" download=""><span class="anchor-text">Download : <span class="download-link-title">Download full-size image</span></span></a></li>
</ol>
<p id="fspara0025"><span class="label">Figure 4</span>. Creatine transporter relative expression in progeny small intestines after 15 wk of maternal GAA supplementation. Examination time points include embryonic day 17 (E17), embryonic day 19 (E19), and day of hatch (DOH). Values are presented as mean fold change ± SEM. Significant differences within a segment between the control and 0.15% GAA groups by <em>t</em> test are marked by an asterix (<em>P</em> &lt; 0.05). Abbreviations: CRT, creatine transporter; GAA, guanidinoacetate.</p>
</figure>
</div>
</section>
<section id="sec3.6">
<h3 id="sectitle0090" class="u-h4 u-margin-m-top u-margin-xs-bottom">The Effect of GAA Supplementation on Progeny Creatine Synthesis Enzyme Relative Expression</h3>
<div>
<p id="p0090">In the kidneys of DOH progeny of the GAA group, AGAT relative expression was decreased 0.63-fold compared with that in progeny of the control group (<em>P</em> = 0.04). In the livers of DOH progeny of the GAA group, GAMT relative expression was decreased 0.52-fold compared with that in progeny of the control group (<em>P</em> = 0.02). Arginine glycine amidinotransferase relative expression in the livers and GAMT relative expression in the kidneys were unaffected by maternal GAA supplementation (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig5" name="bfig5">Figure 5</a>)</p>
<figure id="fig5" class="figure text-xs"><img decoding="async" src="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr5.jpg" alt="" height="520" aria-describedby="cap0030" /></p>
<ol class="links-for-figure">
<li><a class="anchor download-link u-font-sans" title="Download full-size image" href="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr5.jpg" target="_blank" rel="noopener noreferrer" download=""><span class="anchor-text">Download : <span class="download-link-title">Download full-size image</span></span></a></li>
</ol>
<p id="fspara0030"><span class="label">Figure 5</span>. Creatine synthesis gene relative expression in progeny tissues after 15 wk of maternal GAA supplementation. Tissues examined were (A) kidneys and (B) livers. Values are presented as mean fold change ± SEM. Significant differences within a segment between the control and 0.15% GAA groups by <em>t</em> test are marked by an asterix (<em>P</em> &lt; 0.05). Abbreviations: CRT, creatine transporter; GAA, guanidinoacetate.</p>
</figure>
</div>
</section>
</section>
<section id="sec4">
<h2 id="sectitle0095" class="u-h3 u-margin-l-top u-margin-xs-bottom">Discussion</h2>
<p id="p0095">This study presents evidence of molecular mechanisms of GAA transport from broiler breeder feed and subsequent transport of creatine to the hatching egg, resulting in increased egg creatine conent and subsequently affecting creatine synthesis gene expression in day-old broilers. This was the first study to examine the effects of GAA supplementation in broiler breeder feed on creatine content in hatching eggs (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl3" name="btbl3">Table 3</a>). Furthermore, CRT expression was demonstrated for the first time in hen ovaries and ovidcuts (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig1" name="bfig1">Figure 1</a>A), as well as in the YST of broiler embryos (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig1" name="bfig1">Figure 1</a>B).</p>
<section id="sec4.1">
<h3 id="sectitle0100" class="u-h4 u-margin-m-top u-margin-xs-bottom">Guanidinoacetate Supplementation in Broiler Breeder Feed Upregulates GAA and Creatine Absorption and Deposition Into the Hatching Egg</h3>
<p id="p0100">Upregulation of CRT relative expression as a result of GAA supplementation has been previously described in pigs (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib10" name="bbib10">Li et al., 2018</a>). Accordingly, results of the present study demonstrated an increased CRT relative expression in the duodenum of the GAA group, compared with that in the control group (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig2" name="bfig2">Figure 2</a>). This indicates an improved capability of GAA absorption through the digestive tract as a response to the presence of GAA in the ingested feed. Because no significant differences in CRT relative expression were found in the jejunum and ileum segments, it is hypothesized that most GAA absorption takes place in the proximal small intestine, leaving the distal segments unaffected by the supplemented GAA.</p>
<p id="p0105">Nutrients absorbed by the small intestine are transported by the enterocytes lining intestinal villi into the bloodstream, through which they reach various tissues (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib9" name="bbib9">Johnson, 2001</a>). The increase in intestinal CRT relative expression in GAA group hens may thus be linked to the increase in CRT realtive expression in the magnum segment oviduct of these hens. (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig3" name="bfig3">Figure 3</a>B). We specualte that the increase in CRT expression in the hen oviduct is a consequence of an increase in blood creatine after GAA conversion to creatine in the hen kidney and liver, an effect which has been proven for GAA-fed broilers by <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib14" name="bbib14">Majdeddin et al., (2018)</a>. The magnum forms the egg albumen and is responsible for depositing water and nutrients, such as specific egg-white proteins, into the albumen by specific transporters (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib6" name="bbib6">Edwards et al., 1974</a>). Accordingly, a significant increase in creatine content within the albumens of eggs from GAA-fed hens was observed, whereas GAA levels were lower than the detection level in control and GAA-fed hens. Although egg yolk formation occurs within the ovary (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib21" name="bbib21">Perry et al., 1978</a>), no differences were found in the ovary CRT relative expression (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig3" name="bfig3">Figure 3</a>A) to correlate with the significantly increased creatine content in yolks of eggs laid by the GAA group (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl3" name="btbl3">Table 3</a>). This contradiction may be explained by a unique process of nutrient transport in the chicken oocyte, receptor-mediated endocytosis. In contrast to specific transporter-mediated nutrient transfer in other tissues, this process allows for nutrients to be transferred from the bloodstream into the developing yolk as coated vesicles by endocytosis (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib24" name="bbib24">Shen et al. 1993</a>). Thus, it may be possible that the additional creatine in the GAA group&#8217;s egg yolk was deposited into the developing yolk by receptor-medited endocytosis, rather than by the creatine transporter, resulting in unaffected CRT relative mRNA expression.</p>
<p id="p0110">Creatine transporter relative expression in the isthmus was also unaffected by GAA supplementation. This indicates that the egg membranes, which are formed within this segment of the oviduct (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib25" name="bbib25">Stemberger et al., 1977</a>), may not have the same requirements for creatine deposition as the egg albumen.</p>
</section>
<section id="sec4.2">
<h3 id="sectitle0105" class="u-h4 u-margin-m-top u-margin-xs-bottom">Guanidinoacetate Supplementation in Broiler Breeder Feed Downregulates GAA and Creatine Absorption and Synthesis in Their Progeny</h3>
<p id="p0115">Creatine transporter was found to be expressed in the YST during embryonic development (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig1" name="bfig1">Figure 1</a>B), indicating that the YST is able to transport the creatine stored in the yolk content into the embryonic bloodstream. This supports our findings regarding the effects of GAA supplementation in broiler breeder feed on gene expression patterns within the tissues of their progeny. The significant decrease in CRT relative expression in the small intestine of day-old chicks of supplemented hens demonstrates a molecular response within embryonic and hatchling small intestines to the significantly elevated levels of creatine in their egg albumens and yolks (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl3" name="btbl3">Table 3</a>). During the last day of incubation, yolk content is transporterd directly to the embryo&#8217;s intestine via the yolk stalk (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib22" name="bbib22">Romanoff, 1960</a>). Therefore, it was hypothesized that the abundance of creatine within the intestinal lumen allows for lower expression of CRT while maintaining sufficient creatine absorption. Furthermore, this finding may also indicate that high levels luminal creatine may trigger negative control processes resulting in a downregulation of CRT to avoid over absorbance. Accordingly, decreases in CRT relative expression as a result of creatine intake have been documented in various tissues and animal models (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib13" name="bbib13">Loike et al., 1988</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib8" name="bbib8">Guerrero-Ontiveros and Wallimann, 1998</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib3" name="bbib3">Brault et al., 2003</a>).</p>
<p id="p0120">There is a contradiction between the downregulation of intestinal CRT expression in broiler breeder progeny and the upregulation of intestinal CRT expression in their maternal hens after GAA supplementation. This may be owing to the fact that hens ingested GAA from their feed, and GAA supplementation has been shown to increase CRT expression in a previous study (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib11" name="bbib11">Liu et al., 2015</a>). Meanwhile, their progeny received elevated levels of creatine, rather than GAA, from their egg yolks and albumens, thus eliciting the downregulatory response of CRT (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#tbl3" name="btbl3">Table 3</a>).</p>
<p id="p0125">Creatine synthesis genes in hatchlings were also found to be downregulated in response to maternal 0.15% GAA supplementation. In accordance with the previously described sites of action for creatine synthesis enzymes (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib28" name="bbib28">Wyss and Kaddurah-Daouk, 2000</a>), AGAT expression was significantly decreased in the kidneys and GAMT expression was significantly decreased in the livers of progeny of the GAA group at DOH (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig5" name="bfig5">Figure 5</a>). These decreases in relative expression indicate that elevated levels of creatine in the hatching eggs allow for hatchlings to reduce processes of endogenic creatine synthesis within their tissues. This may result in increased availability of arginine and glycine from egg resources for the benefit of the developing embryo and hatchling, as was found in broilers (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib4" name="bbib4">Degroot et al., 2018</a>, <a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#bib5" name="bbib5">Degroot et al., 2019</a>), and allow for directing energetic and nutritional resources toward other physiological processes taking place throughout this critical preriod of development.</p>
<div>
<p id="p0130">To conclude, 0.15% GAA supplementation in broiler breeder feed increased GAA absorbance potential in the maternal small intestine and increased in creatine transfer potential in the oviduct, leading to an elevation in deposited creatine in the yolk and albumen of hatching eggs. This resulted in decreased creatine transport and synthesis potential in late-term embryo and hatchling progeny (<a class="workspace-trigger" href="https://www.sciencedirect.com/science/article/pii/S0032579120302285#fig6" name="bfig6">Figure 6</a>).</p>
<figure id="fig6" class="figure text-xs"><img decoding="async" src="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr6.jpg" alt="" height="369" aria-describedby="cap0035" /></p>
<ol class="links-for-figure">
<li><a class="anchor download-link u-font-sans" title="Download full-size image" href="https://ars.els-cdn.com/content/image/1-s2.0-S0032579120302285-gr6.jpg" target="_blank" rel="noopener noreferrer" download=""><span class="anchor-text">Download : <span class="download-link-title">Download full-size image</span></span></a></li>
</ol>
<p id="fspara0035"><span class="label">Figure 6</span>. Graphical illistration of the core findings in this study<em>.</em> Abbreviation: GAA, guanidinoacetate.</p>
</figure>
</div>
</section>
</section>
</div><div class="fusion-clearfix"></div></div></div></div></div><style type="text/css">.fusion-fullwidth.fusion-builder-row-1 a:not(.fusion-button):not(.fusion-builder-module-control):not(.fusion-social-network-icon):not(.fb-icon-element):not(.fusion-countdown-link):not(.fusion-rollover-link):not(.fusion-rollover-gallery):not(.add_to_cart_button):not(.show_details_button):not(.product_type_external):not(.fusion-quick-view):not(.fusion-rollover-title-link) , .fusion-fullwidth.fusion-builder-row-1 a:not(.fusion-button):not(.fusion-builder-module-control):not(.fusion-social-network-icon):not(.fb-icon-element):not(.fusion-countdown-link):not(.fusion-rollover-link):not(.fusion-rollover-gallery):not(.add_to_cart_button):not(.show_details_button):not(.product_type_external):not(.fusion-quick-view):not(.fusion-rollover-title-link):before, .fusion-fullwidth.fusion-builder-row-1 a:not(.fusion-button):not(.fusion-builder-module-control):not(.fusion-social-network-icon):not(.fb-icon-element):not(.fusion-countdown-link):not(.fusion-rollover-link):not(.fusion-rollover-gallery):not(.add_to_cart_button):not(.show_details_button):not(.product_type_external):not(.fusion-quick-view):not(.fusion-rollover-title-link):after {color: #000000;}.fusion-fullwidth.fusion-builder-row-1 a:not(.fusion-button):not(.fusion-builder-module-control):not(.fusion-social-network-icon):not(.fb-icon-element):not(.fusion-countdown-link):not(.fusion-rollover-link):not(.fusion-rollover-gallery):not(.add_to_cart_button):not(.show_details_button):not(.product_type_external):not(.fusion-quick-view):not(.fusion-rollover-title-link):hover, .fusion-fullwidth.fusion-builder-row-1 a:not(.fusion-button):not(.fusion-builder-module-control):not(.fusion-social-network-icon):not(.fb-icon-element):not(.fusion-countdown-link):not(.fusion-rollover-link):not(.fusion-rollover-gallery):not(.add_to_cart_button):not(.show_details_button):not(.product_type_external):not(.fusion-quick-view):not(.fusion-rollover-title-link):hover:before, .fusion-fullwidth.fusion-builder-row-1 a:not(.fusion-button):not(.fusion-builder-module-control):not(.fusion-social-network-icon):not(.fb-icon-element):not(.fusion-countdown-link):not(.fusion-rollover-link):not(.fusion-rollover-gallery):not(.add_to_cart_button):not(.show_details_button):not(.product_type_external):not(.fusion-quick-view):not(.fusion-rollover-title-link):hover:after {color: #a0ce4e;}.fusion-fullwidth.fusion-builder-row-1 .pagination a.inactive:hover, .fusion-fullwidth.fusion-builder-row-1 .fusion-filters .fusion-filter.fusion-active a {border-color: #a0ce4e;}.fusion-fullwidth.fusion-builder-row-1 .pagination .current {border-color: #a0ce4e; background-color: #a0ce4e;}.fusion-fullwidth.fusion-builder-row-1 .fusion-filters .fusion-filter.fusion-active a, .fusion-fullwidth.fusion-builder-row-1 .fusion-date-and-formats .fusion-format-box, .fusion-fullwidth.fusion-builder-row-1 .fusion-popover, .fusion-fullwidth.fusion-builder-row-1 .tooltip-shortcode {color: #a0ce4e;}#main .fusion-fullwidth.fusion-builder-row-1 .post .blog-shortcode-post-title a:hover {color: #a0ce4e;}</style>
]]></content:encoded>
					
		
		
			</item>
	</channel>
</rss>

<!--
Performance optimized by W3 Total Cache. Learn more: https://www.boldgrid.com/w3-total-cache/?utm_source=w3tc&utm_medium=footer_comment&utm_campaign=free_plugin

Page Caching using Disk: Enhanced 

Served from: www.phiphar.com @ 2026-06-08 18:00:33 by W3 Total Cache
-->